biologia plantarum

International journal on Plant Life established by Bohumil Nìmec in 1959

Biologia plantarum 63:618-626, 2019 | DOI: 10.32615/bp.2019.067

A novel potato microRNA stu-miR856 regulates mitogen-activatedprotein kinase genes contributing to drought tolerance

J.W. YANG1,2, X. ZHU2, S.G. LI2, X. TANG1,2, N. ZHANG1*, H.J. SI1,2
1 College of Life Science and Technology, Gansu Agricultural University, Lanzhou 730070, P.R. China Gansu Provincial Key Laboratory of Aridland Crop Science, Gansu Agricultural University,
2 Lanzhou 730070, P.R. China

Mitogen-activated protein kinases (MAPKs) are significant components of MAPK cascades, which play versatile roles in different transduction pathways to mediate stress adaptation. However, little information is known about post-transcriptional regulation of MAPK genes in plant under drought stress. MicroRNAs (miRNAs), a class of newly identified, short non-coding RNAs, regulate the expression of target genes in plant growth, development, and stress responses. In order to investigate the mechanism of miRNA regulating MAPK genes in potato, we identified a novel potato miRNA with the sequence CGGCCTTAATAAGATGGTGAAG and named it as stu-miR856 depending on miRNA deep sequencing and bioinformatic analysis. Target prediction indicates that it can bind to the coding sequence region of two potato MAPK-like genes, and cleavage positions of them were also effectively validated by RNA ligase-mediated 5' rapid amplification of cDNA ends assay. In addition, expressional analysis shows that stu-miR856 and its targets exhibited an opposite expression pattern: stu-miR856 expression significantly decreased while its target genes greatly increased in the different stages of drought treatment. The results indicate that a decreased expression of stu-miR856 might drive overexpression of two StMAPK genes family members, which may contribute to regulation of the drought adaptation of potato plants.

Keywords: RLM-5' RACE, Solanum tuberosum, StMAPK.

Received: October 4, 2018; Revised: March 18, 2019; Accepted: April 8, 2019; Published online: September 16, 2019  Show citation

ACS AIP APA ASA Harvard Chicago Chicago Notes IEEE ISO690 MLA NLM Turabian Vancouver
YANG, J.W., ZHU, X., LI, S.G., TANG, X., ZHANG, N., & SI, H.J. (2019). A novel potato microRNA stu-miR856 regulates mitogen-activatedprotein kinase genes contributing to drought tolerance. Biologia plantarum, 63, Article 618-626. https://doi.org/10.32615/bp.2019.067
Share...
Download citation
  • BibTeX (.bib)
  • Bookends (.ris)
  • EasyBib (.ris)
  • EndNote (.enw)
  • EndNote 8 (.xml)
  • ISI WoS (.isi)
  • Medlars (.medlars)
  • Mendeley (.ris)
  • MODS (.xml)
  • Papers (.ris)
  • RefWorks (.txt)
  • RefManager (.ris)
  • RIS (.ris)
  • MS Word (.xml)
  • Zotero (.ris)
    • Open full article

    Supplementary files

    Download fileYANG5972 Suppl.pdf

    File size: 874.05 kB

    References

    1. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J.: Basic local alignment search tool. - J. mol. Biol. 215: 403-410, 1990. Go to original source...
    2. Asai, T., Tena, G., Plotnikova, J.: MAP kinase signaling cascade in Arabidopsis innate immunity. - Nature 415: 977-983, 2002. Go to original source...
    3. Bartel, B., Bartel, D.P.: MicroRNAs: at the root of plant development? - Plant Physiol. 132: 709-717, 2003. Go to original source...
    4. Bateman, A., Birney, E., Cerruti, L.: The pfam protein families database. - Nucl. Acids Res. 30: 276-280, 2002. Go to original source...
    5. Beckers, G.J., Jaskiewicz, M., Liu, Y.: Mitogen-activated protein kinases 3 and 6 are required for full priming of stress responses in Arabidopsis thaliana. - Plant Cell 21: 944-953, 2009. Go to original source...
    6. Bonnet, E., Wuyts, J., Rouze, P., Van de Peer, Y.: Detection of 91 potential conserved plant microRNAs in Arabidopsis thaliana and Oryza sativa identifies important target genes. - Proc. nat. Acad. Sci. USA 101: 11511-11516, 2004. Go to original source...
    7. Bonnet, E., Wuyts, J., Rouze, P., Van, P.Y.: Evidence that microRNA precursors, unlike other non-coding RNAs, have lower folding free energies than random sequences. - Bioinformatics 20:2911-2917, 2004. Go to original source...
    8. Cardinale, F., Meskiene, I., Ouaked, F., Hirt, H.: Convergence and divergence of stress-induced mitogen-activated protein kinase signaling pathways at the level of two distinct mitogen-activated protein kinase kinases. - Plant Cell 14: 703-711, 2002.
    9. Chapman, E.J., Prokhnevsky, A.I., Gopinath, K., Dolja, V.V., Carrington, J.C.: Viral RNA silencing suppressors inhibit the microRNA pathway at an intermediate step. - Genes Develop. 18: 1179-1186, 2004. Go to original source...
    10. Chiou, T.J.: The role of microRNAs in sensing nutrient stress. - Plant Cell Environ. 30: 323-332, 2007. Go to original source...
    11. Dai, X., Xu, Y., Ma, Q.: Overexpression of an R1R2R3 MYB gene, OsMYB3R-2, increases tolerance to freezing, drought, and salt stress in transgenic Arabidopsis. - Plant Physiol. 143: 1739-1751, 2007. Go to original source...
    12. Dai, X., Zhao, P.X.: psRNATarget: a plant small RNA target analysis server. - Nucl. Acids Res. 39: W155-W159, 2011. Go to original source...
    13. Ding, Y., Tao, Y., Zhu, C.: Emerging roles of microRNAs in the mediation of drought stress response in plants. - J. exp. Bot. 64: 3077-3086, 2013. Go to original source...
    14. Droillard, M.J., Boudsocq, M., Barbier-Brygoo, H., Lauriere, C.: Involvement of MPK4 in osmotic stress response pathways in cell suspensions and plantlets of Arabidopsis thaliana: activation by hypoosmolarity and negative role in hyperosmolarity tolerance. - FEBS Lett. 574: 42-48, 2004. Go to original source...
    15. Feng, J., Wang, K., Liu, X., Chen, S., Chen, J.: The quantification of tomato microRNAs response to viral infection by stem-loop real-time RT-PCR. - Gene 437: 14-21, 2009. Go to original source...
    16. Griffiths, J.S., Grocock, R.J., Van, D.S., Bateman, A., Enright, A.J.: miRBase: microRNA sequences, targets and gene nomenclature. - Nucl. Acids Res. 34: D140-D144, 2006. Go to original source...
    17. Gu, L., Liu, Y., Zong, X., Liu, L., Li, D.P., Li, D.Q.: Overexpression of maize mitogen-activated protein kinase gene, ZmSIMK1 in Arabidopsis increases tolerance to salt stress. - Mol. Biol. Rep. 37: 4067-4073, 2010. Go to original source...
    18. Guddeti, S., Zhang, D.C., Li, A.L., Leseberg, C.H., Kang, H., Li, X.G., Zhai, W.X., Johns, M.A., Mao, L.: Molecular evolution of the rice miR395 gene family. - Cell. Res. 15: 631-638, 2005. Go to original source...
    19. Guo, H.S., Xie, Q., Fei, J.F., Chua, N.H.: MicroRNA directs mRNA cleavage of the transcription factor NAC1 to down regulate auxin signals for Arabidopsis lateral root development. - Plant Cell 17: 1376-1386, 2005. Go to original source...
    20. Hamel, L.P., Nicole, M.C., Sritubtim, S., other authors?et al.: Ancient signals: comparative genomics of plant MAPK and MAPKK gene families. - Trends Plant Sci. 11: 192-198, 2006. Go to original source...
    21. Hwang, E.W., Shin, S.J., Park, S.C., Jeong, M.J., Kwon, H.B.: Identification of miR17 family members and their putative targets responding to drought stress in Solanum tuberosum. - Genes Genom. 33: 105-110, 2011a. Go to original source...
    22. Hwang, E.W., Shin, S.J., Yu, B.K., Byun, M.O., Kwon, H.B.: miR171 family members are involved in drought response in Solanum tuberosum. - J. Plant Biol. 54: 43-48, 2011b. Go to original source...
    23. Ichimura, K., Mizoguchi, T., Yoshida, R., Yuasa, T., Shinozaki, K.: Protein phosphorylation and dephosphorylation in environmental stress responses in plants. - Adv. Bot. Plant Pathol. 32: 355-377, 2000. Go to original source...
    24. Ichimura, K., Mizoguchi, T., Yoshida, R., Yuasa, T., Shinozaki, K.: Mitogen-activated protein kinase cascades in plants: a new nomenclature. - Trends Plant Sci. 7: 301-308, 2002. Go to original source...
    25. Jonak, C., Ökrész, L., Bogre, L., Hirt, H.: Complexity, cross talk and integration of plant MAP kinase signalling. - Curr. Opin. Plant Biol. 5: 415-424, 2002. Go to original source...
    26. Jones-Rhoades, M.W., Bartel, D.P., Bartel, B.: MicroRNAs and their regulatory roles in plants. - Annu. Rev. Plant Biol. 57: 19-53, 2006. Go to original source...
    27. Kapustin, Y., Souvorov, A., Tatusova, T., Lipman, D.: Splign: algorithms for computing spliced alignments with identification of paralogs. - Biol. Direct. 3: 1-13, 2008. Go to original source...
    28. Kasuga, M., Liu, Q., Miura, S., Yamaguchi, S.K., Shinozaki, K.: Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. - Nat. Biotechnol. 17: 287-291, 2007. Go to original source...
    29. Kawasaki, S., Borchert, C., Deyholos, M., Wang, H., Brazille, S.: Gene expression profiles during the initial phase of salt stress in rice. - Plant Cell 13: 889-905, 2001. Go to original source...
    30. Kidner, C.A., Martienssen, R.A.: The developmental role of microRNA in plants. - Curr. Opin. Plant Biol. 8: 38-44, 2005. Go to original source...
    31. Kong, F., Wang, J., Cheng, L., Liu, S., Wu, J., Peng, Z., Lu, G.: Genome-wide analysis of the mitogen- activated protein kinase gene family in Solanum lycopersicum. - Gene 499: 108-120, 2012. Go to original source...
    32. Kumar, K., Rao, K.P., Sharma, P., Sinha, A.K.: Differential regulation of rice mitogen activated protein kinase kinase (MKK) by abiotic stress. - Plant Physiol. Biochem. 46: 891-897, 2008. Go to original source...
    33. Kumar, A., Farooqi, M.S., Mishra, D.C., Kumar, S., Rai, A., Chaturvedi, K.K., Lal, S.B., Sharma, A.L.: Prediction of miRNA and identification of their relationship network related to late blight disease of potato. - Microrna 7: 11-19, 2018. Go to original source...
    34. Lauter, N., Kampani, A., Carlson, S., Goebel, M., Moose, S.P.: MicroRNA172 down-regulates glossy15 to promote vegetative phase change in maize. - Proc. nat. Acad. Sci. USA. 102: 9412-9417, 2005. Go to original source...
    35. Lee, R.C., Ambros, V.: An extensive class of small RNAs in Caenorhabditis elegans. - Science. 294: 862-864,2001. Go to original source...
    36. Letunic, I., Doerks, T., Bork, P.: SMART 7: recent updates to the protein domain. - Nucl. Acids Res. 40: 302-305, 2012. Go to original source...
    37. Llave, C., Kasschau, K.D., Rector, M.A., Carrington, J.C.: Endogenous and silencing-associated small RNAs in plants. - Plant Cell 14: 1605-1619, 2002. Go to original source...
    38. Lu, Y.H., Sun, R., Shi, C., Clark, L., Li, V.L.: Novel and mechanical stress responsive microRNAs in Populus trichocarpa that are absent from Arabidopsis, - Plant Cell 17: 2186-2203, 2005. Go to original source...
    39. Luan, Y., Wang, W., Liu, P.: Identification and functional analysis of novel and conserved microRNAs in tomato. - Mol. Biol. Rep. 41: 5385-5394, 2014. Go to original source...
    40. Mallory, A.C., Dugas, D.V., Bartel, D.P., Bartel, B.: MicroRNA regulation of NAC domain targets is required for proper formation and separation of adjacent embryonic, vegetative, and floral organs. - Curr. Biol. 14: 1035-1046, 2004. Go to original source...
    41. Mockaitis, K., Howell, S.H.: Auxin induces mitogenic activated protein kinase (MAPK) activation in roots of Arabidopsis seedlings. - Plant J. 24: 785-796, 2000. Go to original source...
    42. Munnik, T., Meijer, H.J.: Osmotic stress activates distinct lipid and MAPK signaling pathways in plants. - FEBS Lett. 498: 172-178, 2001. Go to original source...
    43. Nadarajah, K., Sidek, H.M.: The green MAPKs. - Asian J. Plant Sci. 9: 1-10, 2010. Go to original source...
    44. Nakashima, K., Ito, Y., Yamaguchi-Shinozaki, K.: Transcriptional regulatory networks in response to abiotic stresses in Arabidopsis and grasses. - Plant Physiol. 149: 88-95, 2009. Go to original source...
    45. Noctor, G., Arisi, A.C., Jouanin, L., Foye, C.H.: Manipulation of glutathione and amino acid biosynthesis in the chloroplast, - Plant Physiol. 118: 471-482, 1998. Go to original source...
    46. Palatnik, J.F., Allen, E., Wu, X.: Control of leaf morphogenesis by microRNAs. - Nature 425: 257-263, 2003. Go to original source...
    47. Park, W., Li, J., Song, R., Messing, J., Chen, X.: CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana. - Curr. Biol. 12: 1484-1495, 2002. Go to original source...
    48. Rabbani, M.A., Maruyama, K., Abe, H., Khan, M.A., Katsura, K.: Monitoring expression profiles of rice genes under cold, drought, and high-salinity stresses and abscisic acid application using cDNA microarray and RNA gel-blot analyses. - Plant Physiol. 133: 1755-1767, 2003. Go to original source...
    49. Rao, K.P., Richa, T., Kumar, K., Raghuram, B., Sinha, A.K.: In silico analysis reveals 75 members of mitogen-activated protein kinase kinase kinase gene family in rice. - DNA Res. 17: 139-153, 2010. Go to original source...
    50. Ren, D., Yang, H., Zhang, S.: Cell death mediated by MAPK is associated with hydrogen peroxide production in Arabidopsis. - J. biol. Chem. 277: 559-565, 2002. Go to original source...
    51. Rhoades, M.W., Reinhart, B.J., Lim, L.P., Burge, C.B., Bartel, B., Bartel, D.P.: Prediction of plant microRNA targets. - Cell 110: 513-520, 2002. Go to original source...
    52. Saini, S., Dongen, H.K., Enrigh, S.V.: miRBase: tools for microRNA genomics. - Nucl. Acids Res. 36: D154-D158, 2008. Go to original source...
    53. Samuel, M.A., Ellis, B.E.: Double jeopardy: both over-expression and suppression of a redox-activated plant mitogen-activated protein kinase render tobacco plants ozone sensitive. - Plant Cell 14: 2059-2069, 2002. Go to original source...
    54. Sanan-Mishra, N., Kumar, V., Sopory, S.K., Mukherjee, S.K.: Cloning and validation of novel miRNA from basmati rice indicates cross talk between abiotic and biotic stresses. - Mol. gen. Genom. 282: 462-473, 2009. Go to original source...
    55. Seffens, W., Digby, D.: mRNAs have greater negative folding free energies than shuffled or codon choice randomized sequences. - Nucl. Acids Res. 27: 1578-1584, 1999. Go to original source...
    56. Sunkar, R., Kapoor, A., Zhu, J.K.: Posttranscriptional induction of two Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by downregulation of miR398 and important for oxidative stress tolerance. - Plant Cell 18: 2051-2065, 2006. Go to original source...
    57. Sunkar, R., Li, Y.F, Jagadeeswaran, G.: Functions of microRNAs in plant stress responses. - Trends Plant Sci. 17: 196-203, 2012. Go to original source...
    58. Sunkar, R., Zhu, J.: Novel and stress regulated microRNAs and other small RNAs from Arabidopsis. - Plant Cell 16: 2001-2019, 2004. Go to original source...
    59. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S.: MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. - Mol. Biol. Evol. 28: 2731-2739, 2011. Go to original source...
    60. Teige, M., Scheikl, E., Eulgem, T.: The MKK2 pathway mediates cold and salt stress signaling in Arabidopsis. - Mol. Cells 15: 141-152, 2004. Go to original source...
    61. Vannini, C., Locatelli, F., Bracale, M., Magnani, E., Marsoni, M., Osnato, M., Mattana, M., Baldoni, E., Coraggio, I.: Overexpression of the rice Osmyb4 gene increases chilling and freezing tolerance of Arabidopsis thaliana plants. - Plant J. 37: 115-127, 2004. Go to original source...
    62. Voinnet, O.: Origin, biogenesis, and activity of plant microRNAs. - Cell 136: 669-687. 2009. Go to original source...
    63. Wang, J.W., Wang. L.J., Mao, Y.B., Cai, W.J., Xue, H.W., Chen, X.Y.: Control of root cap formation by microRNA-targeted auxin response factors in Arabidopsis. - Plant Cell 17: 2204-2216, 2005. Go to original source...
    64. Xiong, L., Yang, Y.: Disease resistance and abiotic stress tolerance in rice are inversely modulated by an abscisic acid-inducible mitogen-activated protein kinase. - Plant Cell 15: 745-759, 2003. Go to original source...
    65. Yang, J.W., Zhang, N., Mi, X.X.: Identification of miR159s and their target genes and expression analysis under drought stress in potato. - Comput. Biol. Chem. 14: 204-213, 2014. Go to original source...
    66. Yuasa, T., Ichimura, K., Mizoguchi, T., Shinozaki, K.: Oxidative stress activates ATMPK6, an Arabidopsis homologue of MAP kinase. - Plant Cell Physiol. 42: 1012-1016, 2001. Go to original source...
    67. Zhang, B.H., Pan, X.P., Anderson, T.A.: Identification of 188 conserved maize microRNAs and their targets. - FEBS Lett. 580: 3753-3762, 2006a. Go to original source...
    68. Zhang, B.H., Pan, X.P., Cox, S.B., Cobb, G.P., Anderson, T.A.: Evidence that miRNAs are different from other RNAs. - Cell. mol. Life Sci. 63: 246-254, 2006b. Go to original source...
    69. Zhang, B.H., Wang, Q.L., Wang, K.B., Pan, X.P., Liu, F., Guo, T.L., Cobb, G.P., Anderson, T.A.: Identification of cotton microRNAs and their targets. - Gene 397: 26-37, 2007. Go to original source...
    70. Zhang, L., Li, Y., Lu, W., Meng, F., Wu, C.A., Guo, X.: Cotton GhMKK5 affects disease resistance, induces HR-like cell death, and reduces the tolerance to salt and drought stress in transgenic Nicotiana benthamiana. - J. exp. Bot. 63: 3935-3951, 2012. Go to original source...
    71. Zhang, N., Yang, J., Wang, Z., Wen, Y., Wang, J., He, W., Liu, B., Si, H., Wang D.: Identification of novel and conserved microRNAs related to drought stress in potato by deep sequencing. - PLoS ONE 9: e95489. 2014. Go to original source...
    72. Zhang, X.T., Cheng., T.C, Wang., G.H., Yan, Y.F, Xia, Q.Y.: Cloning and evolutionary analysis of tobacco MAPK gene family. - Mol. Biol. Rep. 40: 1407-1415, 2013. Go to original source...
    73. Zhou, M., Li, D., Li, Z., Hu, Q., Yang, C., Zhu, L.: Constitutive expression of a miR319 gene alters plant development and enhances salt and drought tolerance in transgenic creeping bentgrass. - Plant Physiol. 161: 1375-91, 2013. Go to original source...

    Return to the content