The localizations of sodium exclusion are roots and stem base, however, Na⁺ distribution in these localizations is unclear. Here, we used a salt-tolerant buckwheat cultivar Chuanqiao No.1 and a salt-sensitive cultivar TQ-0808 to demonstrate Na⁺ distribution. We found that Na⁺ content was highest in vacuole, the following was in cell wall or free space, and the least was in cytoplasm. Comparative analysis shows that Na⁺ accumulation in vacuole, cell wall, or free space of roots and stem base in 'Chuanqiao No.1' was obviously higher than in 'TQ-0808'; in contrast, Na⁺ accumulation in cytoplasm of 'Chuanqiao No.1' was less than in 'TQ-0808'. These results indicate that the capabilities of Na⁺ extrusion and Na⁺ compartmentalization of salt-tolerant buckwheat were obviously higher than of the salt-sensitive one, and the capabilities could effectively restrict Na⁺ transport to shoot. Compartmentalization of Na⁺ in the vacuole was the main way for Na⁺ exclusion of salt-tolerant buckwheat. In addition, the transcriptions of Na⁺/H⁺ antiporter 1 and salt overly sensitive 1 were remarkably higher in 'Chuanqiao No.1' than in 'TQ-0808', which is consistent with the above results.

Columnar apple is a valuable resource for genetic improvement of cultivated apples due to its special tree architecture. Strigolactones (SLs) are a novel class of plant hormones controlling shoot branching. The content of SLs is higher in columnar apple than in standard apples. In this study, the members of major gene families involved in SLs biosynthesis and signaling were identified from apple genomic sequences and their expression profiles were characterized in columnar and standard apples using reverse transcription quantitative polymerase chain reactions. In comparison with standard apple, the higher expressions of MORE AXILLARY GROWTH genes MdMAX3-1 and MdMAX4-4 were detected in both buds and shoots of columnar apple but the expression of DWARF gene MdD53-4 showed a lower expression in columnar apple. Overexpression of Columnar gene MdCo31 in tobacco increased SLs content and weakened the inhibition of SLs signal transduction by increasing expression of MAX3 and down-regulating the transcription of D53. Thus MdCo31 could be a strong candidate gene for the control of columnar habit.

The effects of exogenous nitric oxide (NO) and ethylenediaminetetraacetic acid (EDTA) on cadmium toxicity and accumulation in ryegrass (Lolium perenne L.) were studied in a hydroponic experiment. The results show that in plants without Cd application, addition of EDTA and sodium nitroprusside (SNP, an exogenous NO donor) significantly reduced the plant height, root length, and root activity of ryegrass, and significantly increased the O₂^*- generation rate and H₂O₂ and malondialdehyde (MDA) content in the aboveground and underground parts of ryegrass. Cadmium stress significantly inhibited ryegrass growth. Addition of SNP or EDTA alleviated Cd toxicity, and addition of both had a better effect. Compared with Cd alone, the shoot height and root length in the Cd+EDTA+SNP treatment increased by 68.8 and 59.6 %, and plant fresh and dry masses by 62.6 and 60.0 %, respectively. Also, the superoxide dismutase activity in the shoots and roots increased by 32.5 and 67.6 %, the peroxidase activity by 49.8 and 67.6 %, the ascorbate peroxidase activity by 134 and 102 %, the MDA content decreased by 30.4 and 21.8 %, and the O₂^*- generation rate by 29.0 and 26.1 %, respectively. At the same time, Cd content in the shoots and roots increased significantly by 89.7 and 30.2 %, respectively. Overall, the results suggest that exogenous NO could enhance Cd tolerance of ryegrass, but addition of EDTA could promote plant Cd uptake. Combined application of NO and EDTA increased Cd accumulation in the aboveground parts of ryegrass. In this experiment, the treatment of 100 µM CdCl₂ + 0.25 mM EDTA + 50 μM SNP showed the best effects in promoting Cd accumulation in ryegrass and enhancing its Cd tolerance.

To study the biological function of activity of bcl complex (ABC1) proteins in Lepidium apetalum Willd., genes encoding ABC1 family proteins were identified from the seed transcriptome. The sequence most closely related to germination at a low temperature was selected and gene expressions in response to low temperature stress further studied. The results show that 21 ABC1 genes were expressed in seeds germinating at the low temperature: 4 genes were upregulated, 6 were downregulated, and 11 were not significantly different from controls. The results of fluorescence quantification of the low-temperature stress on the seedlings of 7-d-old L. apetalum showed that seven genes were up-regulated, six genes were down-regulated, and eight genes had no significant difference. Real-time quantitative PCR results show that under the low temperature stress, the expression of the LaAbc1-3 gene increased, but its expression decreased after some time. The expression of this gene increased again after removing the low temperature stress. The expression of LaAbc1-21 gene in L. apetalum seedlings showed a trend of decreasing first and then increasing. The LaAbc1-3 gene was insensitive to salt stress. Expression of the LaAbc1-21 gene was significantly up-regulated during the salt stress. Under osmotic stress, the expression of the LaAbc1-3 gene was down-regulated, and the expression was negatively correlated with polyethylene glycol (PEG-6000) concentration. Under the PEG-6000 treatment, the expression of the LaAbc1-21 gene was significantly up-regulated, and the expression was positively correlated with concentration. These results provide a basis for further analysis of the role of the ABC1 genes in the stress resistance of L. apetalum.

Heptahelical protein (HHP) signalling pathway is involved in cold acclimation responses to low temperature and other stresses. The HHP transcription factor family is the key component regulating this signalling pathway. In this study, five HHP-like genes, BcHHP1, BcHHP2, BcHHP3, BcHHP4, and BcHHP5, were isolated from non-heading Chinese cabbage (Brassica rapa ssp. chinensis cv. Suzhouqing). Multiple sequence alignment and phylogenetic analysis showed that BcHHP proteins are highly homologous to HHP proteins from Arabidopsis thaliana, Glycine max, Oryza sativa, and Zea mays. Some of these HHP proteins might share similar functions in some aspects, which might be further proved by interaction network of BcHHP genes. Furthermore, real-time quantitative PCR showed that BcHHP1 was induced under cold and salt treatments. Besides, BcHHP1 was also accumulated in response to abscisic acid and salicylic acid, indicating that BcHHP1 gene might participate in response to hormone treatments. In addition, a BcHHP1-YFP fusion protein was localized to the nucleus and cytoplasm. These results indicated that five BcHHP genes might play important roles in a functional HHP signalling pathway responding to cold treatment. This work might be useful for future functional analysis of other HHP-like genes.

The vesicle trafficking process, which involves exocytotic and endocytotic pathways, has been reported to play a role in regulating plant responses to different environmental stresses. The Exo70 protein is important for the localization of the exocyst in the plasma membrane; however, its role in the physiology of stress tolerance is currently unclear. In this study, we characterized NbExo70D1, an Exo70 gene from tobacco (Nicotiana benthamiana). It was shown to have a role in the plant response to salt stress. More specifically, tolerance to salt stress is conferred by the overexpression of the dominant negative nbexo70d1 domain D mutation in transgenic tobacco. In addition, a reduced accumulation of reactive oxygen species (ROS) under salt treatment was observed in the transgenic lines compared to the wild type. Treatment with diphenylene iodonium, an NADPH oxidase inhibitor, resulted in a decrease in salt stress-triggered ROS production in the roots of both wild type tobacco and transgenic tobacco. Furthermore, there was a reduction in NADPH oxidase activity in the transgenic plants under salt treatment, which indicates NbExo70D1 is involved in NADPH oxidase-mediated ROS production. We also characterized the tissue-specific expression patterns of NbExo70D1 during salt stress response by expressing the ProNbExo70D1-β-glucuronidase reporter construct in plants. Importantly, the GFP-NbExo70D1 fusion protein was localized in both the plasma membrane and the cytoplasm; expressing the dominant negative mutation disrupted the interaction between NbExo70D1 protein and the plasma membrane. Overall, our study suggests that Exo70 plays an important role in regulating the production and transmission of ROS as part of a salt stress response in plants.

This study investigated the mitigating effects of spermidine (Spd) application on salinity-induced ion inbalance, physiological properties, and the expression of some genes in foxtail millet (Setaria italica L.). We observed 30-d-old seedlings maintained at a half-strength Hoagland solution (control), 1.0 % NaCl, 10, 20, and 40 μM Spd, and 10, 20, and 40 μM Spd + 1.0 % (m/v) NaCl for 14 d. The results show that salt stress significantly inhibited plant growth, and this was significantly ameliorated by Spd. The mass of the shoots and roots, content of chlorophyll a and chlorophyll b, root activity, and K⁺ content were higher whereas Na⁺ content, Na⁺/K⁺ ratio, relative electrolyte leakage, glutathione content, H₂O₂ content, activity of glutathione reductase (GR), and catalase (CAT) were lower after application of Spd in comparison with NaCl alone. The expression of GR, ascorbate peroxidase, CAT, and superoxide dismutase genes also significantly decreased in salt stressed plants with Spd. This study has proved the role of Spd in alleviating salt stress in foxtail millet and identified that 20 μM Spd was most effective.

Waterlogging, a major environmental stress, impairs plant growth and development and induces synthesis of different proteins. To understand the molecular mechanisms coupled with morpho-physiological alterations underlying waterlogging tolerance, the LTQ-FTICR MS/MS technique was employed to map the proteomes of leaves of sesame grown under control and waterlogged conditions. The waterlogging treatment caused dramatic alterations in morphological and biochemical properties of the leaves of sesame. For proteome analysis, more than 75 reproducible protein spots were identified on 2-DE gels wherein 51 protein spots (≥ 1.5-fold change) were used for analysis by mass spectrometry. Among 51 differentially abundant proteins, 20 were specific to the 10-leaf stage and 31 were specific to the flowering stage. Most of the differentially abundant proteins were involved in group metabolism, and energy and stress defense. Oxygen-evolving enhancer protein 1, ATP synthase subunit, heat shock proteins, glutamine synthetase, glyceraldehyde-3-phosphate dehydrogenase, and superoxide dismutase were upregulated under waterlogging. However, the photosynthesis- and protein biosynthesis-related proteins (e.g., ribulose-1,5-bisphosphate carboxylase/oxygenase activase, and S-adenosylmethionine synthase 1) were down-regulated under waterlogging. The protein interaction network indicates that energy metabolism- and stress- and defense-related proteins were involved in the protein-protein interaction network, which could form an indispensable network in sesame leaves. To this end, physiological results highlighted the impairment of photosyntheis, which is consistent with results obtained at the proteome level. The upregulation of metabolism-, energy-, and stress defense-related proteins in response to waterlogging stress may provide new insights into the complex mechanisms underlying waterlogging tolerance in sesame.

Wheat (Triticum aestivum L.) is leading cereal crop worldwide, but its yield is highly affected due to various diseases, especially Fusarium head blight (FHB), which affects the metabolism of plants. The present study was conducted at the Agricultural Institute Osijek using three winter wheat cultivars (Apache, Bezostaya1, and U1) during 2016/2017. The objectives of our studies were to examine differences in physiological characteristics of FHB resistance among wheat cultivars in the early stage of infection. The FHB incidence and severity was the highest in 'Bezostaya1'. Results suggest that activation of some anti-oxidative enzymes in the first 2 h after Fusarium attack was not efficient to prevent disease. 'Apache', which revealed an average FHB incidence, efficiently activated defence response through phenol metabolism elevation. The most effective defence response trough activation of anti-oxidative enzymes triggered by H₂O₂ was revealed in 'U1', which resulted in a minimal FHB incidence and disease severity. The obtained results confirm differences in defence strategies of wheat genotypes.

Tomato is an economically important vegetable. Tomato chlorosis virus (ToCV) and Tomato yellow leaf curl virus (TYLCV) are two major viruses that cause serious losses to tomato production. The effective method to control these two viruses is to breed antiviral species by genetic engineering techniques. In order to obtain the RNA interference (RNAi) expression vector of tomato, the coat protein (CP) genes of ToCV and TYLCV were selected in this study. The tandem sequences of the two CP genes were obtained using the recombinant PCR technique. Using Gateway cloning technology, the RNAi expression vector pRNAi-ToCV-TY including the two CP genes was constructed by attB×attP and attL×attR recombination reactions. Polymerase chain reaction and sequencing analysis confirmed that the vector was obtained successfully and contained the ToCV and TYLCV CP genes. The RNAi expression vector pRNAi-ToCV-TY was transformed into Agrobacterium strain GV3101. The RNAi vector was then used to transform tomato. The objective fragments were successfully transformed into a tomato by PCR identification. At the fourth-leaf stage, the positive transgenic plants were challenged with ToCV and TYLCV. Out of 15 transgenic plants, 33 % showed early symptoms within 4 weeks post-infection (WPI); 20 % showed delayed symptoms (5 - 7 WPI); and the remaining 47 % were symptomless even after 9 WPI. The untransformed control plants (90 %) showed severe symptoms within 2 - 4 WPI, whereas 10 % delayed symptoms.

A unique structural feature of plant sterols is the presence of a 24-alkyl group in the sterol side chain, which is synthesized by C24-sterol methyltransferase (SMT). Here we report for the first time that the bread wheat genome (AABBDD) contains at least three homoeologous genes encoding C24-sterol methyltransferase 1. While these copies have similar coding regions, they differ markedly in the nucleotide sequences of their non-coding regions. Sequencing de novo of the promoter regions of the TaSMT1 homoeologs demonstrated the occurrence of common and specific stress-sensitive cis-elements such as LTR, the cis-element involved in low temperature response. These cis-elements, along with other factors, determine the differences in the effects of stress on the expression of homoeologous TaSMT1 genes. For example, TaSMT1-5A is constitutively expressed in the roots and leaves, while TaSMT1-4D gene is highly stress-responsive. Another important enzyme involved in sterol biosynthesis is C22-sterol desaturase, which converts β-sitosterol into stigmasterol. This enzyme is encoded by homoeologous TaCYP710A8 genes, which, in contrast to TaSMT1, are all up-regulated in response to stress. Cold-induced expression of TaCYP710A8 is greater in roots than in leaves. This may be due to the higher cold sensitivity of the roots and the necessity to increase the amount of stigmasterol known as a “stress sterol”. Our findings suggest that the existence of homoeologous genes of sterol biosynthesis in polyploid plants supports the diversity of genetic mechanisms of sterol-mediated response of plants to stresses.

Calmodulin-binding transcription activators (CAMTAs) play important roles in plant growth, developmental processes, and responses to abiotic and biotic factors. Recently, five CAMTA members were identified in Citrus sinensis, however, very little is known about the molecular regulation of these CAMTAs in citrus during fruit development and under abiotic stresses. In this study, the different expression profiles of CsCAMTA genes were found in different tissues and different fruit developmental stages. The CsCAMTA genes also displayed distinct expression patterns after heat, cold, salt, and drought stresses. Furthermore, the expressions of CsCAMTA genes were significantly induced by treatments with salicylic acid, methyl jasmonate, or abscisic acid. The green fluorescent protein gene fused with CsCAMTA was specifically expressed in the nucleus of Nicotiana benthamiana cells. Additionally, CsCAMTA proteins can activate or suppress DNA transcription in yeast. These findings provide helpful information for further studies of stress signals in citrus.

Mitogen-activated protein kinases (MAPKs) are significant components of MAPK cascades, which play versatile roles in different transduction pathways to mediate stress adaptation. However, little information is known about post-transcriptional regulation of MAPK genes in plant under drought stress. MicroRNAs (miRNAs), a class of newly identified, short non-coding RNAs, regulate the expression of target genes in plant growth, development, and stress responses. In order to investigate the mechanism of miRNA regulating MAPK genes in potato, we identified a novel potato miRNA with the sequence CGGCCTTAATAAGATGGTGAAG and named it as stu-miR856 depending on miRNA deep sequencing and bioinformatic analysis. Target prediction indicates that it can bind to the coding sequence region of two potato MAPK-like genes, and cleavage positions of them were also effectively validated by RNA ligase-mediated 5' rapid amplification of cDNA ends assay. In addition, expressional analysis shows that stu-miR856 and its targets exhibited an opposite expression pattern: stu-miR856 expression significantly decreased while its target genes greatly increased in the different stages of drought treatment. The results indicate that a decreased expression of stu-miR856 might drive overexpression of two StMAPK genes family members, which may contribute to regulation of the drought adaptation of potato plants.

Pyramiding transgenes of interest is one of the strategies to engineer multiple stress resistance in crop plants. Transgenic plants which stably express different genes can be hybridized to bring these genes together in one plant. Transgenic rice (Oryza sativa L. cv. ASD 16) plants harbouring genes Xa21 (conferring bacterial blight resistance), tlp (conferring resistance to sheath blight), or gna (conferring resistance to brown planthopper) were used in hybridization experiments. Sexual hybridization was carried out in two different gene combinations: Xa21 × gna and tlp × gna. Molecular analyses were carried out to confirm the presence of transgenes. In F₁ generation, lines harbouring either gene in each of the cross-combination were selected and forwarded to F₂ generation. The presence of genes in F₂ generation was confirmed by PCR, Southern blot hybridization, and Western blotting. The F₂ progeneis harbouring Xa21 and gna exhibited resistance against bacterial blight and moderate resistance against brown planthopper. Similarly, the F₂ lines of tlp and gna combination provided resistance against sheath blight and moderate resistance against brown planthopper. The level of resistance observed in pyramided lines for insect or pathogens was comparable to the resistance observed in their parental lines. Our study shows that pyramiding genes by hybridization between transgenic plants could be one of the strategies to develop cultivars with multiple biotic stress resistances.

London plane (Platanus acerifolia Wild.) is a famous landscape plant because of its numerous desirable traits except the abundant pollens and seed hairs, which not only pollute the environment but also affect human health. To resolve these problems, we herein isolated and functionally analyzed the promoter of PlacSEP1.1, an orthologous gene of Arabidopsis SEPALLATA1, and investigated the potential usability for cell ablation strategies to engineer reproductive sterility in plants. A 2130 bp 5' upstream region of PlacSEP1.1 was isolated and termed pPlacSEP1.1. Putative motif detections show that there were several types of motifs in pPlacSEP1.1 including core promoter elements, tissue-specific expression regulatory elements, and some negative regulatory elements. β-Glucuronidase histochemical and quantitative assay showed that pPlacSEP1.1 of all deletions was active in all detected tissues except the shortest deletion D5 in roots. In order to test whether pPlacSEP1.1 could be used for London plane sterility breeding with a cytotoxic gene Barnase, the pPlacSEP1.1::Barnase and pPlacSEP1.1::Barnase-mic35S-Barstar vectors were constructed and transformed into tobacco. The pPlacSEP1.1::Barnase transgenic tobacco showed serious defects with respect to vegetative development and died within a couple of weeks after transplantation. On the other hand, most pPlacSEP1.1::Barnase-mic35S-Barstar transgenic tobacco showed normal vegetative growth and inflorescence, and flower development prevented phenotype.

γ-Aminobutyric acid (GABA) regulates plant tolerance to abiotic stresses; however, a transcriptomic change and key stress-related genes induced by GABA have not been investigated in plants during a prolonged period of salt stress. Roots of creeping bentgrass (Agrostis stolonifera) cv. Penncross were pretreated with or without 0.5 mM GABA solution for 2 days and then subjected to salt stress for 20 days (150 mM NaCl solution for 3 d, 200 mM NaCl for another 3 d, and 250 mM NaCl for 14 d) in controlled growth chambers. The application of GABA significantly increased GABA content in roots and alleviated a salt-stress induced decrease in GABA content in leaves. This was associated with a significant increase in salt tolerance as demonstrated by a significantly higher leaf relative water content, photochemical efficiency, performance index on absorption basis, and lower electrolyte leakage in GABA-pretreated plants as compared to untreated plants under salt stress. Transcriptomic analysis found that GABA-induced salt tolerance was closely associated with saccharide, amino acid, and lipid metabolism. The GABA upregulated key differentially expressed genes including cytochrome P450 (CYP450), zinc transporter 29 (ZTP29), alpha-amylase 3 (AMY3), 3-ketoacyl-CoA synthase 6 (KCS6), aldehyde oxidase (AO), acetyl-CoA carboxylase 1 (ACC1), and magnesium-chelatase (Mg-CHT) involved in zinc homeostasis, starch degradation, and the biosynthesis of wax, fatty acid, chlorophyll, and abscisic acid, which could contribute to GABA-regulated salt tolerance. Current findings prove that GABA application is an efficient approach to enhance salt tolerance of creeping bentgrass during a prolonged period of salt stress and also provide valuable information to better understand key candidate genes and regulatory pathways of GABA-induced salt tolerance in plants.

Based on information from the Arabidopsis model system, a putative transcriptional activator of cuticle formation (TaSHN1) was selected among the expressed sequence tags in wheat (Triticum aestivum L.). RT-PCR indicated the preferential expression of this gene in the basal, but not in the middle parts of wheat leaves. This leaf region is a likely site of cuticle formation in cereals. TaSHN1 was cloned and expressed in Arabidopsis, resulting in shiny leaf surfaces and the overproliferation of cuticular material as observed by electron microscopy. Unlike the Arabidopsis WAX INDUCER/SHINE1 (WIN/SHN1) gene, TaSHN1 triggered disorganized cuticular ultrastructure in the transgenic leaves, with the continuous layers replaced by large electrodense bodies embedded in amorphous lipid material. Toluidine blue staining and dark-adapted water release indicated increased cuticular permeability in TaSHN1-expressing Arabidopsis leaves. The expression of TaSHN1 resulted in a moderate decrease of the total number of stomata per unit leaf area in comparison with the wild type. Drought tolerance of Arabidopsis was unaffected by the transgene. The data indicate that this putative wheat orthologue of WIN/SHN transcription factors (TaSHN1) elicited both overlapping and new, distinctive phenotypes compared to other WIN/SHN-overexpressing plants. TaSHN1 transgenic Arabidopsis lines should provide a rich source of material for further comparative biochemical, physiological, and genetic studies.

The response of functional traits of plants to external environment can influence their competitive ability because these functional traits are required for the acquisition of resources. The overuse of silver nanoparticles (AgNPs) has gained attention due to their environmental toxicity. This study aimed to examine the effects of AgNPs with different concentrations and particle sizes on functional traits of wheat. It was observed that AgNPs significantly reduced the plant height and so decrease its competitive ability. Ag ions decreased leaf chlorophyll and nitrogen content and specific leaf area more than AgNPs, but the opposite was true for leaf length, single leaf fresh mass, and shoot fresh mass. Hence, the toxicity of AgNPs may be higher than that of Ag ions in some cases. In this study, leaf chlorophyll and nitrogen content decreased with increasing concentration of AgNPs (with size 30 nm). The AgNPs with smaller particle size exerted higher toxicity on leaf chlorophyll and N content than those with larger particle size at the same concentration. However, AgNPs with larger particle size reduced more aboveground fresh mass than those with smaller particle size at the same concentration.

Leaf venation and coupled physiological function of wild plants co-evolve during the natural selection. How artificial selection affects leaf vein traits and coordinated physiological functions of main crops are largely unknown. This study examined the changes of leaf vein traits and their correlation with gas exchange of flag leaves and yield in eight wheat genotypes of differing ploidy under the same growing conditions. The results indicate that flag leaf vein density (VLA), major-vein density (VLA_major), and minor-vein density (VLA_minor) decreased whereas the proportion of minor-vein length and interveinal distance between small longitudinal veins (IVD) increased during the polyploidization process, and the major advance occurred from the period from diploids to tetraploids. The VLA, VLA_major, and VLA_minor were closely coordinated with maximum net photosynthetic rate (P_N) and photosynthetic N use efficiency (PNUE), but not with stomatal conductance. The proportion of minor-vein length and IVD were negatively related with P_N and PNUE but positively related with N content per area (N_area) during wheat evolution. A higher proportion of minor-vein length and IVD, and a lower VLA_major in flag leaves along with a larger N_area were largely responsible for the increased yield in modern cultivars. The decreased redundancy of leaf vein density and increased minor-vein proportion in modern cultivars can confer a yield advantage during wheat evolution.

Dendrobium officinale is a traditional Chinese medicinal herb that produces promising bioactive polysaccharides. However, the biosynthetic pathway of polysaccharides in this herb remains to be elucidated. The uridine diphosphate glucose pyrophosphorylase (UGPase) is a key enzyme for the production of uridine diphosphate glucose, which is a major glycosyl donor for synthesis of polysaccharides. This study identified a novel UGPase gene from D. officinale termed as DoUGP. Bioinformatics and subcellular-localization of the DoUGP protein indicate that it belongs to the UGPase-A type and was localized in cytoplasm. The DoUGP was revealed to be constitutively expressed in all organs, and the highest mRNA content was detected in stems, the organs with the highest polysaccharide content. Furthermore, sucrose feeding experiments in D. officinale demonstrate that sucrose addition could increase DoUGP transcription significantly and enhance polysaccharide accumulation accordingly. Together, we conclude that DoUGP probably plays an important role in polysaccharide biosynthesis of D. officinale and is a potential target for quality breeding of this orchid.

The WRKY transcription factors (TFs) are integral parts of signaling pathways that regulate many processes, such as senescence, seed dormancy, seed germination, and resistance to abiotic and biotic stresses. Stress-related functions of WRKY6 have been characterized in Arabidopsis and other plant species, but its role has not been identified in apple. Here, we cloned WRKY6 genes from Malus prunifolia. Two homologues MpWRKY6a and MpWRKY6b found in this species were members of Group II WRKY6 TFs. They were localized to the cell nucleus. MpWRKY6a can bind to W-boxes. Compared with the untransformed wild type plants, MpWRKY6a-overexpressing Arabidopsis plants were more sensitive to methyl jasmonate (MeJA) and less sensitive to methyl viologen and abscisic acid (ABA), which suggests its role in responses to oxidative stress and MeJA or ABA signaling. The results fill a gap in the WRKY6 function in apple and provide basis for resistance improvement of Malus.

Melatonin (MT), a tryptophan derivative, plays an important role in the function and survival of organisms. To better understand the role of MT in cold tolerance, the melon (Cucumis melo L.) were sprayed with various concentrations of MT (0, 50, 100, 200 or 400 μM), exposed to cold stress (day/night temperature of 12/6 °C) for 7 d, and then returned to optimal conditions (28/18 °C) for 7-d recovery. The foliar application of MT (especially 200 μM) significantly alleviated cold-induced growth suppression, and MT-treated plants recovered more quickly than untreated plants. Further, MT-treated plants had higher chlorophyll content, photosynthetic rate, stomatal conductance, as well as maximal quantum yield of photosystem (PS) II photochemistry, and efficiency of excitation energy capture of open PS II centres under cold stress than untreated plants. Furthermore, exogenous MT significantly reduced malondialdehyde content and markedly increased the activities of antioxidant enzymes superoxide dismutase (SOD), guaiacol peroxidase (POD), and catalase (CAT) under cold stress. MT also increased expression of antioxidant genes CmSOD, CmPOD, and CmCAT under cold stress. The results indicate that MT pretreatment alleviated the detrimental effects of cold stress and accelerateds the recovery mainly by enhancing photosynthesis and antioxidant capacity in melon leaves.

Phalaenopsis species are among the most popular potted flowers for their fascinating flowers. When their whole-genome sequencing was completed, they have become useful for studying the molecular mechanism of anthocyanin biosynthesis. Here, we identified 49 candidate anthocyanin synthetic genes in the Phalaenopsis genome. Our results showed that duplication events might contribute to the expansion of some gene families, such as the genes encoding chalcone synthase (PeCHS), flavonoid 3'-hydroxylase (PeF3'H), and myeloblastosis (PeMYB). To elucidate their functions in anthocyanin biosynthesis, we conducted a global expression analysis. We found that anthocyanin synthesis occurred during the very early flower development stage and that the flavanone 3-hydroxylase (F3H), F3'H, and dihydroflavonol 4-reductase (DFR) genes played key roles in this process. Over-expression of Phalaenopsis flavonoid 3',5'-hydroxylase (F3'5'H) in petunia showed that it had no function in anthocyanin production. Furthermore, global analysis of sequences and expression patterns show that the regulatory genes are relatively conserved and might be important in regulating anthocyanin synthesis through different combined expression patterns. To determine the functions of MYB2, 11, and 12, we over-expressed them in petunia and performed yeast two-hybrid analysis with anthocyanin (AN)1 and AN11. The MYB2 protein had strong activity in regulating anthocyanin biosynthesis and induced significant pigment accumulation in transgenic plant petals, whereas MYB11 and MYB12 had lower activities. Our work provided important improvement in the understanding of anthocyanin biosynthesis and established a foundation for floral colour breeding in Phalaenopsis through genetic engineering.

Ent-kaurene oxidase (EKO) catalyze three sequential oxidations in the early steps of gibberellin biosynthesis pathway. In this research, a cDNA sequence of InEKO1 gene in the model short-day plant Ipomoea nil was identified. Our studies revealed that inductive conditions for flowering caused an increase in the transcriptional activity of the examined gene in the cotyledons-the main organs for the perception of the photoperiodic stimulus. In contrast, in the second half of the 16 h long inductive night and after that, a decreased amount of InEKO1 mRNA in the apexes was detected. What is more, ethylene, the key inhibitor of flower induction in I. nil, elevated the InEKO1 expression exclusively in the cotyledons between 10 and 14 h of the inductive night.

Senescence is the last developmental stage in plants during which recycling of nutrients takes place from senescing organs to newly formed organs such as young leaves and developing seeds. In the present work, senescence induced alterations in mineral ions, chlorophylls, carotenoids, betacyanin, betaxanthin, proteins, amino acids, sugars, starch, and polyphenols were monitored in shoots of an extreme halophyte Salicornia brachiata. A sharp decline in the content of chlorophylls, carotenoids, and proteins in the shoot was noticed at middle and late stages of senescence in comparison with early stage. However, the content of betacyanin, betaxanthin, total soluble sugars, reducing sugars, and starch increased significantly in senescing shoots. The total free amino acid content decreased gradually with the progress of senescence. The content of major minerals did not change significantly with the progress of senescence, whereas marked changes in content of minor minerals were observed. From this study, it was concluded that the sugars and starch accumulating in senescing shoots might be transported into developing seeds to serve as storage nutrients. The accumulation of betacyanin and betaxanthin in senescing shoots suggests that these pigments may act as scavengers of reactive oxygen species during senescence. This study provides comprehensive information on the variations in the utilization of mineral nutrients and organic metabolites with progressing senescence in the halophyte S. brachiata.

Casuarina equisetifolia is widely planted in coastal areas of tropical and subtropical regions as windbreaks or to stabilize dunes against wind erosion due to its high salt tolerance and nitrogen-fixing ability. To investigate the mechanisms responsible for its salt tolerance, we examined growth, mineral composition, expression of genes for sodium (Na⁺) and potassium (K⁺) transport proteins, and antioxidant responses under NaCl treatments. Increasing NaCl concentrations inhibited lateral root elongation and decreased plant height, length of internodes, and numbers of branches and twigs. The Na⁺ content significantly increased whereas the K⁺ content significantly decreased in both shoots and roots with increasing external NaCl concentration, resulting in a significant increase in Na⁺/K⁺ ratio. Most of the Na⁺/H⁺ antiporter genes (NHXs) were obviously upregulated in roots after 24 and 168 h of salt stress, and NHX7 was especially induced after 168 h. Almost all salt overly sensitive (SOS) genes were induced after 168-h treatment. Additionally, activities of superoxide dismutase, glutathione peroxidase, and catalase were significantly changed in shoots and roots under salt stress. Hence, we conclude that salinity tolerance of C. equisetifolia mainly relied on sequestering excess Na⁺ into vacuoles and on induced expression of NHX and SOS genes in roots and thus the maintenance of sufficient K⁺ content in shoots.

Fructans play vital roles in enhancing plant abiotic stress tolerance by reducing oxidative damage, stabilizing cell membranes, improving the osmotic adjustment capacity, and lowering the freezing point. In this study, a sucrose: fructan-6-fructosyltransferase (6-SFT) gene involved in the synthesis of fructans was isolated from Dasypyrum villosum, Dv-6-SFT, using genomic walking and reverse transcription (RT)-PCR. Alignment of the cDNA sequence with its genomic counterpart showed that no introns were present in the Dv-6-SFT gene, and thus it differs from all other plant 6-SFTs that have been cloned previously. Sequence analysis showed that the cDNA of the Dv-6-SFT sequence comprised 2 175 bp with a 1 863 bp open reading frame, and its deduced protein comprised 620 amino acids with a predicted molecular mass of 68.47 kDa. The Dv-6-SFT gene was transferred into tobacco (Nicotiana tabacum L.) cv. W38 via Agrobacterium-mediated transformation. The screened plants were tested by PCR and semi-quantitative RT-PCR, and the transgenic plants were evaluated under drought, cold, and salt stresses. The Dv-6-SFT transgenic tobacco plants had higher resistance to drought, cold, and salt stress than the non-transgenic plants. Further analysis showed that the transgenic plant expressing Dv-6-SFT had increased content of saccharides and proline, but reduced content of malondialdehyde in leaves. The results of this study demonstrate that the Dv-6-SFT gene is a potential candidate for conferring abiotic stress tolerance in plants and it could be used in crop improvement breeding programs.

Mapping of quantitative trait genes (QTGs) associated with drought related traits is essential for improving drought tolerance in crop species. In silico identification of candidate genes relies on annotation of critical QTGs to a variety of web resource-based datasets. The barley reference sequence was employed to map QTGs significantly associated with the proline accumulation and osmotic potential. Annotation of the critical QTGs contigs to the NCBI protein database identified 72 gene orthologs located on chromosomes 1H, 2H, and 7H, from which seven genes were identified as candidates. Expression analysis of all seven candidate genes revealed differential expression pattern between plants grown under well-watered conditions and drought-stress. The results represent a successful and highly powerful implementation of genome-wide scanning approach based on in silico mapping of QTGs to identify gene clusters having a common transcript pattern with similar function.

Sucrose is a dominant sugar transported to the sink organs of a plant where it is metabolized to other compounds or stored. Here, the importance of sucrose metabolism in a drought-tolerant wheat cultivar was compared to a drought-sensitive one. The 4-d-old Triticum aestivum L. seedlings were exposed to drought induced by water cessation for 7 d and recovery after re-watering for further 7 d. Under control conditions, constitutive expression of genes encoding vacuolar invertase (VI) and sucrose synthase (SuS) and activity of sucrose phosphate synthase (SPS) were significantly higher in the tolerant cultivar than in the sensitive one. Drought promoted the expressions of SPS and VI genes in the tolerant cultivar and increased their activities to 175 and 132 %, respectively, of those under control conditions. The activity of SuS and expression of its gene, however, were identical in both cultivars under drought stress. These changes resulted in more remarkable accumulation of sucrose in tolerant than in sensitive cultivar under water stress.

An efficient plant regeneration protocol has been established for two commercial Populus hybrid clones, MC (Populus × euramericana) and UNAL (Populus × interamericana). The culture of internode segments on Murashige and Skoog (MS) medium with 0.5 μM α-naphthalene acetic acid (NAA) and 4 μM N⁶-benzyladenine for 7 weeks (2 weeks in absence of activated charcoal and 5 weeks in its presence) resulted in the highest frequency of shoot regeneration (100 % for MC and 82 % for UNAL). All regenerated shoots longer than 2 cm rooted on half-strength MS medium, independent of the addition of 0.1 μM NAA. Nevertheless, shoots developed better-formed roots in NAA-free medium, which had a positive effect on the acclimatization of plants. In order to know the cellular processes underlying in vitro shoot organogenesis, a histological study was made in UNAL internode-explants. Results revealed that in vitro culture caused swelling around the cut-off zones in all explants, but only those undergoing organogenesis formed proliferation centers under subepidermal cells, which led to formation of bud primordia. Moreover, in vivo tissues and explants with different in vitro response showed different immunolabelling patterns when they were treated with fluorescentmonoclonal antibodies directed to several pectin-polysaccharides of the cell wall. Results allow us to assign a predominant role of homogalacturonan with a low degree of methyl-esterification in the initiation of bud primordia, role of β-1,4-D-galactan side chains of rhamnogalacturonan-I in the cellular differentiation, role of α-1,5-L-arabinan side chains of rhamnogalacturonan-I and of homogalacturonan with a high degree of methyl-esterification in cell division and growth.