biologia plantarum

International journal on Plant Life established by Bohumil Němec in 1959

Fulltext search in archive



« advanced mode »

 previous    ...   3   4   5   6   7  8   9   10   11   12   ...    next 

Results 181 to 210 of 6170:

Genes involved in stress signals: the CBLs-CIPKs network in cold tolerant Solanum commersonii

S. ESPOSITO, V. D'AMELIA, D. CARPUTO*, R. AVERSANO*

Biologia plantarum 63:699-709, 2019 | DOI: 10.32615/bp.2019.072

Several studies revealed the important contribution of calcineurin B-like (CBLs) and CBL-interacting kinase (CIPKs) genes in transmitting stress signals in plants. Taking advantage from the genome sequences of the cultivated potato Solanum tuberosum and its wild relatives S. commersonii and S. chacoense, we identified for the first time 10 CBLs and 26 CIPKs genes in each species. The CBLs and CIPKs derived from tandem duplications indicate that these gene families in potato mainly arise through amplification mechanisms. Once annotated, we compared the par excellence model of Arabidopsis thaliana with S. commersonii, the potato model species for studying cold tolerance. We found that four ScCBL proteins (ScCBL1, ScCBL4a, ScCBL4b, and ScCBL9) started with a conserved N-myristoylation motif (MGXXXS/T), which might function in membrane targeting of the CBLs-CIPKs complex. Additionally, expression analyses of S. commersonii CBL and CIPK genes based on RNAseq revealed diverse expression patterns following various abiotic and biotic stresses and in the four tissues analyzed (flowers, leaf, roots, and tubers). Data also suggest that the ScCBLs-ScCIPKs complex may be more responsive to abiotic rather than biotic stimuli. Overall, the results described in the present work will be useful for future investigations and for functional characterization of individual CBLs and CIPKs in Solanum.

Genome-wide analysis of heptahelical protein (HHP) gene family and expression of BcHHP1 in response to stresses in Brassica rapa

J. Wang, F.Y. Huang, X.L. Hou, X. You

Biologia plantarum 63:219-227, 2019 | DOI: 10.32615/bp.2019.025

Heptahelical protein (HHP) signalling pathway is involved in cold acclimation responses to low temperature and other stresses. The HHP transcription factor family is the key component regulating this signalling pathway. In this study, five HHP-like genes, BcHHP1, BcHHP2, BcHHP3, BcHHP4, and BcHHP5, were isolated from non-heading Chinese cabbage (Brassica rapa ssp. chinensis cv. Suzhouqing). Multiple sequence alignment and phylogenetic analysis showed that BcHHP proteins are highly homologous to HHP proteins from Arabidopsis thaliana, Glycine max, Oryza sativa, and Zea mays. Some of these HHP proteins might share similar functions in some aspects, which might be further proved by interaction network of BcHHP genes. Furthermore, real-time quantitative PCR showed that BcHHP1 was induced under cold and salt treatments. Besides, BcHHP1 was also accumulated in response to abscisic acid and salicylic acid, indicating that BcHHP1 gene might participate in response to hormone treatments. In addition, a BcHHP1-YFP fusion protein was localized to the nucleus and cytoplasm. These results indicated that five BcHHP genes might play important roles in a functional HHP signalling pathway responding to cold treatment. This work might be useful for future functional analysis of other HHP-like genes.

Proteome analysis of sesame leaves in response to waterlogging stress at vegetative and flowering stages

H.-J. JUNG, S.K. ROY, S.-W. CHO, S.-J. KWON, C. KUN, H.-C. CHUN, S.-H. WOO

Biologia plantarum 63:733-749, 2019 | DOI: 10.32615/bp.2019.062

Waterlogging, a major environmental stress, impairs plant growth and development and induces synthesis of different proteins. To understand the molecular mechanisms coupled with morpho-physiological alterations underlying waterlogging tolerance, the LTQ-FTICR MS/MS technique was employed to map the proteomes of leaves of sesame grown under control and waterlogged conditions. The waterlogging treatment caused dramatic alterations in morphological and biochemical properties of the leaves of sesame. For proteome analysis, more than 75 reproducible protein spots were identified on 2-DE gels wherein 51 protein spots (≥ 1.5-fold change) were used for analysis by mass spectrometry. Among 51 differentially abundant proteins, 20 were specific to the 10-leaf stage and 31 were specific to the flowering stage. Most of the differentially abundant proteins were involved in group metabolism, and energy and stress defense. Oxygen-evolving enhancer protein 1, ATP synthase subunit, heat shock proteins, glutamine synthetase, glyceraldehyde-3-phosphate dehydrogenase, and superoxide dismutase were upregulated under waterlogging. However, the photosynthesis- and protein biosynthesis-related proteins (e.g., ribulose-1,5-bisphosphate carboxylase/oxygenase activase, and S-adenosylmethionine synthase 1) were down-regulated under waterlogging. The protein interaction network indicates that energy metabolism- and stress- and defense-related proteins were involved in the protein-protein interaction network, which could form an indispensable network in sesame leaves. To this end, physiological results highlighted the impairment of photosyntheis, which is consistent with results obtained at the proteome level. The upregulation of metabolism-, energy-, and stress defense-related proteins in response to waterlogging stress may provide new insights into the complex mechanisms underlying waterlogging tolerance in sesame.

Identification of candidate reference genes in tropical bamboos stable across species, tissues, and developmental stages

S. Chakraborty, S. Dutta, P. Biswas, M. Das

Biologia plantarum 63:253-261, 2019 | DOI: 10.32615/bp.2019.029

Bamboo possesses many unique physiological characteristics, but the molecular understanding of many of these processes remains poorly understood till to date. One major reason is unavailability of sufficient sequence and expression data. Selection of suitable reference genes is pivotal to initiate any gene expression analyses. Although, suitable reference genes have been identified in the temperate bamboo Phyllostachys edulis, it has not been done for tropical bamboo. In this study, expression stability of 10 candidate reference genes were investigated in 4 widely grown tropical bamboo species (Bambusa tulda, B. balcooa, B. bambos, and B. vulgaris), different organs (young leaves from flowering and non flowering culms, flag leaf (leaf just below the mature inflorescence), possible flag leaf (leaf covering the immature inflorescence), culm sheath, internode, root, rhizome, and inflorescence bud), different parts (basal, middle, and tip regions of leaf; internodes located in the basal, middle, and tip region of the branch, and developmental stages early, middle, and late inflorescence buds) by using 3 reliable computational tools (geNorm, NormFinder, and RefFinder). A universal single reference gene for normalization of gene expression data was not identified. However, the eukaryotic initiation factor 4α (eIF4α), clathirin adaptor complexes medium subunit (CAC), and nucleotide tract-binding protein (NTB) were found stable in the selected organs across different bamboo species. On the other hand, eIF4α ranked top when different organs and peptidyl prolyl cis-trans isomerase/cyclophilin (CYP), eukaryotic elongation factor 1α (eEF1α) and ubiquitin 5 (UBQ5) ranked top when different developmental stages of B. tulda were analyzed. Taken together, this study not only identifies reference gene/s that are stable across species, organs, and developmental stages of bamboo, but it also assesses the impacts of major contributing factors regulating expression stability of the reference genes.

Rare earth elements in plants

M. Kovaříková, I. Tomášková, P. Soudek

Biologia plantarum 63:20-32, 2019 | DOI: 10.32615/bp.2019.003


Since 1960, the positive effects of rare earth elements (REE) on crop physiology have been observed, and support for photosynthesis, biomass accumulation, secondary metabolites, or enzymes has been reported in 40% of studies. A higher content of chlorophylls a and b as well as carotenoids have been found along with an increased efficiency of photosystem II photochemistry and electron transfer rates. An increased activity of a key photosynthetic enzyme was also found in several plants growing in soil with a higher content of REE. An appropriate amount of REE also activates the antioxidant activity of peroxidase, superoxide dismutase, and catalase. These enzymes, together with a higher content of flavonoids and carotenoids, increase the resistance of plants to oxidative stress caused by different abiotic stresses. The positive effect of REE on biomass accumulation was also confirmed, but their affection on mycorrhizal symbiosis remains ambiguous. On the other hand, an excess of REE leads to damage to plants including the chloroplast ultrastructure. Therefore, the positive and negative effects of REE remain controversial, and the mechanisms of effects of REE in plants remain poorly understood. In addition to physiological processes, the absorption, bioavailability, and translocation of REE in plants as well as their possible ecotoxicology and hyperaccumulation are discussed in this review.

An overexpression of the AP2/ERF transcription factor from Iris typhifolia in Arabidopsis thaliana confers tolerance to salt stress

J. WU, J. ZHANG, X. LI, J. LIU, Z. NIU, L. WANG*

Biologia plantarum 63:776-784, 2019 | DOI: 10.32615/bp.2019.082

The roles of ethylene responsive factors (ERFs) and their positive and negative regulations of abiotic stress tolerance have been widely reported. This study reports the characterization of ItERF from Iris typhifolia Kitag with respect to molecular and functional properties. The 867 bp cDNA fragment of ItERF was cloned by reverse transcription PCR from I. typhifolia. Real-time quantitative PCR revealed that ItERF expression was induced in the roots, stems, and leaves of I. typhifolia after NaCl treatment, and that ItERF expressions were significantly higher in the leaves and roots than in the stems. A green fluorescent protein marker revealed that ItERF was located to the nucleus. Plant survival and root growth of ItERF transgenic Arabidopsis thaliana L. seedlings were much better than those of the wild type under NaCl stress. Malondialdehyde content in the transgenic lines was significantly lower than that in the wild type. Growth of yeast transformants showed an enhanced tolerance to salt stress than non-transformed yeast cells. All of the results verified that the expression of ItERF had effects on plant growth under salt stress.

Exogenous spermidine enhances expression of Calvin cycle genes andphotosynthetic efficiency in sweet sorghum seedlings under salt stress

A.I. EL SAYED, M.A.M. EL-HAMAHMY, M.S. RAFUDEEN, M.K.H. EBRAHIM

Biologia plantarum 63:511-518, 2019 | DOI: 10.32615/bp.2019.046

Salinity adversely affects plants resulting in disruption to plant growth and physiology. Previously, it has been shown that these negative effects can be alleviated by various exogenous polyamines. However, the role of spermidine (Spd) in conferring salinity tolerance in sorghum is not well documented. The effect of exogenous Spd on the responses of sweet sorghum (Sorghum bicolor L.) seedlings to salt stress (150 mM NaCl) was investigated by measuring photosynthetic carbon assimilation, Calvin cycle enzyme activities, and the the expression of respective genes. Application of 0.25 mM Spd alleviated the negative effects of salt stress on efficiency of photosystem II and CO2 assimilation and increased the activities of ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco) and aldolase. Salt stress significantly lowered the transcriptions of genes encoding Rubisco large subunit, Rubisco small subunit, 3-phosphoglyceric acid kinase, glyceraldehyde-3-phosphate dehydrogenase, triose-3-phosphate isomerase, fructose-1,6-bisphosphate aldolase, fructose-1,6-bisphosphate phosphatase, and sedoheptulose-1,7-bisphosphatase. However, transcriptions of genes encoding phosphoribokinase and Rubisco were up-regulated. The Spd application enhanced expressions of most of these genes. It appears Spd conferred salinity tolerance to sweet sorghum seedlings by enhancing photosynthetic efficiency through regulation of gene expressions and activities of key CO2 assimilation enzymes.

The RNA-seq transcriptome analysis identified genes related to rice seed dormancy

K. Xie, J. Bai, Y.Y. Yang, N.B. Duan, Y.M. Ma, T. Guo, F.Y. Yao, H.F. Ding

Biologia plantarum 63:308-313, 2019 | DOI: 10.32615/bp.2019.035


Plant hormones play important roles in seed dormancy and dormancy breaking. We measured the hormone content in rice (Oryza sativa L. cv. Nona Bokra) seeds at different stages and with or without imbibition treatment. We identified 1 265 differentially expressed genes (DEGs) between dormant and dormancy-broken seeds using RNA-seq analysis: 1 015 genes were significantly up-regulated, while 250 genes were significantly down-regulated. Sixteen DEGs were selected as related to seed dormancy, and their expressions were validated using quantitative PCR. Three DEGs were in the same position as two reported dormancy QTLs, suggesting that they may be candidate genes that control the dormancy of rice seeds. Our study provides an important basis for cloning genes in dormant rice seeds and provides theoretical support for the study of the dormancy mechanism.

Genome-wide identification of circular RNAs in tomato seeds in response to high temperature

R. Zhou, X.Q. Yu, L.P. Xu, Y.L. Wang, L.P. Zhao, T.M. Zhao, W.G. Yu

Biologia plantarum 63:97-103, 2019 | DOI: 10.32615/bp.2019.012

Circular RNAs (circRNAs), an emerging class of non-coding RNAs, are abundant in eukaryotic transcriptomes. Seed germination is one of the most important stages in the entire life cycle of plants that can be slowed down or totally restrained by high temperature. Our aim is to identify heat-responsive circRNAs and explore the potential function of circRNAs in tomato seeds at high temperature. Following high-throughput sequencing, 4 164 circRNAs were identified, and 980 circRNAs were shared in the control and high-temperature libraries. Among the 748 circRNAs with high expressions, 73 circRNAs were significantly up-/down- regulated in tomato seeds germinated at high temperature compared to the control. The parental genes of circRNAs existing in seeds only at high temperature were mainly involved in metabolic processes, cellular processes, catalytic activities, and binding based on Gene Ontology analysis. The results suggested that circRNAs were widespread in tomato and were generated from different chromosomes and diverse genomic regions. Some circRNAs in tomato seeds responded to high temperature during germination. This study provides the first genome-wide profile of circRNAs in response to high temperature during tomato seed germination and lays a foundation for studying the potential biological functions of circRNAs responding to heat stress.

Promoter activity of genes encoding the Specific Tissue protein family in the reproductive organs of Medicago truncatula

L. ALBORNOS, I. MARTÍN, E. LABRADOR*, B. DOPICO

Biologia plantarum 63:785-796, 2019 | DOI: 10.32615/bp.2019.111

The "Specific Tissue" (ST) are proteins of unknown function present only in some plant families, mainly Fabaceae and Asteraceae. They are included in the PF10950 protein family and characterized by the presence of at least one domain of unknown function (DUF)2775. In this work we studied the involvement of the six members of the Medicago truncatula ST family (ST1 to ST6) in the development of flowers, fruits, and seeds by analysing the activity of their promoters (pST) after the construction of M. truncatula transgenic plants expressing the b-glucuronidase (GUS) reporter gene under the control of the six pSTs. The GUS activity was analysed in whole flowers and fruits and also in histological sections of these organs. The pST expression in the reproductive organs was mainly associated with the vascular bundles, especially throughout fruit development. These results pointed to an important role of ST proteins during the reproductive development stage, related to nutrient mobilization during the fruit and seed formation, that could be facilitated by their presence in the pod vascular bundles, as well as in the connective tissue of the anthers (ST3, ST4, ST6), in the placenta, the funiculus, and the outer parts of the developing seed (ST2, ST3, ST6). The observations made in this study were in agreement with the functions previously established for the three groups of M. truncatula ST proteins, as in the proposed function for ST1 in the transport and assimilation of nutrients, or the involvement of ST4, ST5, and ST6 in floral defence.

A novel potato microRNA stu-miR856 regulates mitogen-activatedprotein kinase genes contributing to drought tolerance

J.W. YANG, X. ZHU, S.G. LI, X. TANG, N. ZHANG, H.J. SI

Biologia plantarum 63:618-626, 2019 | DOI: 10.32615/bp.2019.067

Mitogen-activated protein kinases (MAPKs) are significant components of MAPK cascades, which play versatile roles in different transduction pathways to mediate stress adaptation. However, little information is known about post-transcriptional regulation of MAPK genes in plant under drought stress. MicroRNAs (miRNAs), a class of newly identified, short non-coding RNAs, regulate the expression of target genes in plant growth, development, and stress responses. In order to investigate the mechanism of miRNA regulating MAPK genes in potato, we identified a novel potato miRNA with the sequence CGGCCTTAATAAGATGGTGAAG and named it as stu-miR856 depending on miRNA deep sequencing and bioinformatic analysis. Target prediction indicates that it can bind to the coding sequence region of two potato MAPK-like genes, and cleavage positions of them were also effectively validated by RNA ligase-mediated 5' rapid amplification of cDNA ends assay. In addition, expressional analysis shows that stu-miR856 and its targets exhibited an opposite expression pattern: stu-miR856 expression significantly decreased while its target genes greatly increased in the different stages of drought treatment. The results indicate that a decreased expression of stu-miR856 might drive overexpression of two StMAPK genes family members, which may contribute to regulation of the drought adaptation of potato plants.

Differential expressions of citrus CAMTAs during fruit development and responses to abiotic stresses

Z.G. Ouyang, L.F. Mi, H.H. Duan, W. Hu, J.M. Chen, T. Peng, B.L. Zhong

Biologia plantarum 63:354-364, 2019 | DOI: 10.32615/bp.2019.041


Calmodulin-binding transcription activators (CAMTAs) play important roles in plant growth, developmental processes, and responses to abiotic and biotic factors. Recently, five CAMTA members were identified in Citrus sinensis, however, very little is known about the molecular regulation of these CAMTAs in citrus during fruit development and under abiotic stresses. In this study, the different expression profiles of CsCAMTA genes were found in different tissues and different fruit developmental stages. The CsCAMTA genes also displayed distinct expression patterns after heat, cold, salt, and drought stresses. Furthermore, the expressions of CsCAMTA genes were significantly induced by treatments with salicylic acid, methyl jasmonate, or abscisic acid. The green fluorescent protein gene fused with CsCAMTA was specifically expressed in the nucleus of Nicotiana benthamiana cells. Additionally, CsCAMTA proteins can activate or suppress DNA transcription in yeast. These findings provide helpful information for further studies of stress signals in citrus.

Proteomic analysis provides integrated insight into mechanisms of Turnip mosaic virus long distance movement in Brassica rapa

C. Liu, G.-S. Sun, R.-J. Zhang, S.-W. Lv, L. Gao, L.-W. Gao, T.-K. Liu, D. Xiao, X.-L. Hou, C.-W. Zhang

Biologia plantarum 63:164-173, 2019 | DOI: 10.32615/bp.2019.019

In non-heading Chinese cabbage, the yield relies mostly on the health of leaves, which can be heavily impacted by turnip mosaic virus (TuMV). The virions or viral ribonucleoprotein complexes are transported through the phloem and xylem. Plasmodesmata are indispensable because they traverse cell walls and connect companion cells, allowing virus particles long distance movement. However, which complexes and genes participate in this process is still unknown. Plants can activate defense mechanisms and apply disease resistance genes to respond to pathogen attacks. In this study, we collected the stems and petioles infected by TuMV for 7 d (TuMV-7), 14 d (TuMV-14), and 21 d (TuMV-21). Using isobaric tags for relative and absolute quantification-based proteomic technology, 6 043 distinct proteins were identified and 323, 240, 285, 203, 253, and 363 differentially expressed proteins were found in the comparable pairs of TuMV-7/control, TuMV-14/TuMV-7, TuMV-14/control, TuMV-21/TuMV-7, TuMV-21/TuMV-14, and TuMV-21/control, respectively. We performed a functional annotation analysis of all identified proteins and a functional enrichment analysis of all differentially expressed proteins. The results indicated that the long distance movement of TuMV involved many complex regulatory pathways. The respective proteins were related to those occurring in plasmodesmata and to Ca2+ transporters. Further, we also found proteins related to heat shock proteins, pathogenesis-related proteins, and proteins scavenging reactive oxygen species.

A methyl jasmonate induced defensin like protein from Panax notoginseng confers resistance against Fusarium solani in transgenic tobacco

Q. WANG, B.L. QIU, S. LI, Y.P. ZHANG, X.M. CUI, F. GE, D.Q. LIU

Biologia plantarum 63:797-807, 2019 | DOI: 10.32615/bp.2019.123

Plant defensins and defensin like protein (DEFL) form a large family of small cysteine-rich proteins. They are major components of plant immune systems, being involved in host defenses against biotic and abiotic stresses. In this study, a novel defensin like protein (DEFL) gene PnDEFL1 was isolated from Panax notoginseng, a traditional Chinese medicinal herb. The expression patterns of PnDEFL1 after treatment with methyl jasmonate, salicylic acid, ethephon, and H2O2, as well as during Fusarium solani infection, were analyzed using reverse transcription qPCR. The up-regulated expression of PnDEFL1 indicated that it responded to F. solani infection and all four defense-related signalling molecules. The PnDEFL1 gene was further fused with the green fluorescent protein gene in a plant expression vector and transformed into onion (Allium cepa) epidermal cells. The laser scanning confocal microscope confirmed that the PnDEFL1 protein localized to the extracellular region. In addition, the recombinant PnDEFL1 protein was expressed in Escherichia coli and purified by affinity chromatography. It had antifungal activities against F. solani, F. oxysporum, Botrosphaeria dothidea, and Sclerotinia sclerotiorum. The PnDEFL1 gene was transferred into tobacco (Nicotiana tabacum) to verify its function. The overexpression of PnDEFL1 in tobacco conferred a high resistance to F. solani infection. Thus, the PnDEFL1 gene is involved in the defense responses of P. notoginseng to F. solani infection.

Response of two Arabidopsis ecotypes Columbia-0 and Dijon-G to necrotrophic and biotrophic pathogens

Y.H. LEE, J.Y. MOON, H.J. KIM, J.M. PARK, I.S. HWANG, J.K. HONG

Biologia plantarum 63:654-661, 2019 | DOI: 10.32615/bp.2019.071

Arabidopsis thaliana L. ecotype Dijon-G (Di-G) showed a different symptom development during pathogenesis compared to ecotype Columbia-0 (Col-0). Previously, it has been shown that Di-G has a higher susceptibility to necrotrophic fungus Alternaria brassicicola than Col-0. In this study, Di-G showed enhanced disease susceptibility to necrotrophic fungi Botrytis cinerea, Sclerotinia sclerotiorum, and Sclerotium rolfsii known to secrete oxalic acid (OA) as a pathogenicity factor. Treatment with 50 and 100 mM OA resulted in a more leaf tissue collapse in Di-G than in Col-0. The OA also up-regulated expression of the salicylic acid (SA)-inducible pathogenesis-related gene 1 (PR1) and down-regulated expression of the jasmonic acid/ethylene-inducible defensin PDF1.2 gene in Di-G. By contrast, Di-G was resistant to hemibiotrophic fungus Colletotrichum higginsianum and biotrophic Turnip crinkle virus (TCV) infections. Application of 0.5 mM SA resulted in a higher accumulation of endogenous SA and in a preferential expression of SA-responsive genes in Di-G. Salicylic acid accelerated OA-triggered plant cell death and attenuated PDF1.2 expression in Di-G. These results suggest that the enhanced susceptibility of Di-G to necrotrophic pathogen infections might be mediated by attenuated JA-ethylene defence signalling and/or heightened SA-related defence signalling. Interaction of SA-signalling with OA secretion might be also involved in the enhanced susceptibility of Di-G.

Overexpression of wheat TaNCED gene in Arabidopsis enhances tolerance to drought stress and delays seed germination

S.-M. Tong, H.-X. Xi, K.-J. Ai, H.-S Hou

Biologia plantarum 61:64-72, 2017 | DOI: 10.1007/s10535-016-0692-5

Abscisic acid (ABA) regulates various plant physiological processes, especially participates in the plant responses to harsh environments. The 9-cis-epoxycarotenoid dioxygenase (NCED) is a key enzyme in ABA biosynthesis pathway. Here, a TaNCED with an 1 887-bp open reading frame was cloned from wheat, which encodes a peptide of 628 amino acids. A chloroplast transit peptide sequence was found at the N-terminus of the TaNCED protein. Multiple sequence alignments indicate that the TaNCED protein shared high similarities with other NCEDs from different species. Real-time quantitative PCR analysis shows that expression of TaNCED was strongly up-regulated by treatments with ABA, polyethylene glycol, and drought stress, and it was down-regulated during germination of the wheat seeds. Ectopic overexpression of the TaNCED gene in Arabidopsis resulted in an increase of endogenous ABA and free proline content. A lower water loss rate and stomatal conductance of leaves were found in the transgenic plants in comparison with the wild type. Subsequently, the transgenic plants displayed an enhanced tolerance to drought stress but delayed seed germination. These data provide evidence that the TaNCED might play a primary role in regulation of ABA content during water stress and seed dormancy.

Expression of sucrose metabolism and transport genes in cassava petiole abscission zones in response to water stress

W. B. Liao, Y. Y. Li, C. Lu, M. Peng

Biologia plantarum 61:219-226, 2017 | DOI: 10.1007/s10535-016-0658-7

Cassava (Manihot esculenta Crantz) is an important crop, and its starch formation is regulated by sucrose metabolism and transport. To understand the roles of sucrose metabolism and transport in cassava under water stress, we studied not only sucrose metabolism and transport in cassava abscission zones (AZs) but also expression of respective genes. Sucrose was transported from leaves to roots in the early stage of water stress, and a reverse sucrose flow was detected in the later stages of the stress. The decrease in sucrose content was related to leaf senescence and inhibition of photosynthesis. Microarray analyses showed seven genes encoding sucrose synthase, nine genes encoding sucrose transporters, and eight genes encoding invertase in the cassava AZs under the water stress. Reverse transcription quantitative PCR confirmed two sucrose synthase and two invertase genes significantly upregulated under the stress, whereas one sucrose transporter gene was downregulated. The sucrose synthase and invertase gene expressions were negatively correlated with sucrose content under water stress, whereas sucrose transporter gene expressions were positively correlated with sucrose content.

Protection of Artemisia annua roots and leaves against oxidative stress induced by arsenic

A. Kumari, N. Pandey, S. Pandey-Rai

Biologia plantarum 61:367-377, 2017 | DOI: 10.1007/s10535-016-0686-3

The present study was conducted to examine differential responses of roots and leaves of Artemisia annua to different arsenic concentrations (50, 100, and 150 μΜ) and treatment durations (1, 3, 5, or 7 d). The values of bioconcentration factor and translocation factor calculated on the basis of total As-accumulation in roots and shoots suggested that A. annua is a good As-accumulator. Above and below ground plant biomass was enhanced at 100 μΜ As but at 150 μΜ As was significantly reduced. As-treatment caused membrane damage more in the roots than in the leaves as reflected by higher degree of lipid peroxidation in the roots than in the leaves. In response to As stress, plants activated antioxidative defense for detoxification of induced reactive oxygen species (ROS), As sequestration via phytochelatins (PCS) as well as production of a wide range of secondary metabolites. All of them were activated differently in roots and leaves. Among enzymatic antioxidants, leaves significantly elevated superoxide dismutase (SOD), ascorbate peroxidase, and glutathione reductase, whereas in roots SOD, catalase, and peroxidase played significant role in ROS detoxification. Plants activated As-sequestration pathway through thiols, glutathione, and PCS and their respective genes were more induced in leaves than in roots. Further gas chromatography in tandem with mass spectroscopy analysis revealed differential modulation of secondary metabolites in leaves and roots to sustain As-stress. For example, roots synthesized linoleic acid (4.85 %) under As-treatment that probably stimulated stress-signalling pathways and in turn activated differential defense mechanisms in roots to cope up with the adverse effects of As.

Detection of DNA methylation pattern in thidiazuron-induced blueberry callus using methylation-sensitive amplification polymorphism

A. Ghosh, A. U. Igamberdiev, S. C. Debnath

Biologia plantarum 61:511-519, 2017 | DOI: 10.1007/s10535-016-0678-3

During the normal developmental process, programmed gene expression is an essential phenomenon in all organisms. In eukaryotes, DNA methylation plays an important role in the regulation of gene expression. The extent of cytosine methylation polymorphism was evaluated in leaf tissues collected from the greenhouse grown plants and in in vitro-derived callus of three lowbush and one hybrid blueberry genotypes, using methylation-sensitive amplification polymorphism (MSAP) technique. Callus formation started from the leaf segments after 4 weeks of culture on a thidiazuron (TDZ) containing medium. Maximum callus formation (98 %) was observed in the hybrid blueberry at 1.0 mg dm-3 TDZ. Although noticeable changes in cytosine methylation pattern were detected within the MSAP profiles of both leaf and callus tissues, methylation events were more polymorphic in calli than in leaf tissues. The number of methylated CCGG sites varied significantly within the genotypes ranging from 75 to 100 in leaf tissues and from 215 to 258 in callus tissues. Differences in the methylation pattern were observed not only in a tissue-specific manner but also within the genotype in a treatment specific manner. These results demonstrated the unique effect of TDZ and the tissue culture process on DNA methylation during callus development.

Transcription factor NnDREB1 from lotus improved drought tolerance in transgenic Arabidopsis thaliana

L. B. Cheng, J. J. Yang, L. Yin, L. C. Hui, H. M. Qian, S. -Y. Li, L. -J. Li

Biologia plantarum 61:651-658, 2017 | DOI: 10.1007/s10535-017-0718-7

Dehydration responsive element binding factor (DREB) is believed to be a stress-tolerance enhancer in plants. In the present study, a cold-binding factor (CBF)/DREB homologous gene NnDREB1 (XP_010242642.1) was isolated from lotus roots using rapid amplification of cDNA ends (RACE) and reverse transcription (RT)-PCR methods. Analysis of the deduced amino acid sequence and phylogeny classified NnDREB1 into the A-1 group of the DREB1 subfamily. Expression profiling using a quantitative PCR method revealed that NnRDEB1 was significantly induced by NaCl, mannitol, and polyethylene glycol, but not by low temperature and abscisic acid. To evaluate function of NnRDEB1, Arabidopsis thaliana was transformed with the NnDREB1 gene in a binary vector construct. The transgenic plants exhibited higher resistance to drought compared with the wild-type plants in terms of survival rates, dry and fresh masses, and chlorophyll content. In addition, overexpression of NnDREB1 resulted in higher germination rates compared with the wild type plants on MS medium containing mannitol. The expressions of downstream target stressrelated genes, including cold-regulated15B (COR15B), rare cold inducible 2B (RCI2B) and repeat domain 26 (RD26), were activated in the transgenic plants. Taken together, the results suggest that NnDREB1 might be an important protein in lotus root drought tolerance.

Responses of Pinus massoniana seedlings to lead stress

L. L. Zhang, X. M. Zhu, Y. W. Kuang

Biologia plantarum 61:785-790, 2017 | DOI: 10.1007/s10535-017-0710-2

To investigate the biochemical and physiological responses of Masson pine (Pinus massoniana Lamb.) seedlings to lead stress, needles, stems, and roots of two-year-old seedlings were treated with 207PbCO3 for 33 d and then analyzed 1 and 7 d after the treatment was completed. Chlorophyll (Chl) b responded more sensitively than Chl a to needle Pb treatment, and the Chl content in the needles significantly decreased after Pb application to roots. The malondialdehyde and proline content remained almost unchanged, but superoxide dismutase and catalase activities increased on day 1 after all ways of Pb application. The reduced glutathione (GSH) content and GSH/oxidized glutathione ratio increased on day 1 after Pb application to stem or needles compared to the controls. At 7 d after the Pb application, the increase in dehydroascorbate (DHA) content and the decrease in the ascorbate (AsA)/DHA ratio implied a decreased antioxidant capacity of AsA. The results indicated that the antioxidants were sensitive to the Pb treatments and might be involved in the Masson pine tolerance to Pb stress.

Construction of a new type of multi-gene plant transformation vector and genetic transformation of tobacco

Y. Dong, Y. C. Ren, M. S. Yang, J. Zhang, T. Qiu, H. L. Cui

Biologia plantarum 61:13-23, 2017 | DOI: 10.1007/s10535-016-0684-5

A plasmid and two isocaudamer systems, namely, NotI/Bsp120I and SpeI/XbaI/NheI, were used to construct a new type of multi-gene plant transformation vector system. This system included a transformation vector containing the restriction enzyme cutting sites Bsp120I and XbaI as well as a cloning vector containing the restriction enzyme cutting sites NotI, Bsp120I, SpeI, and NheI. The open reading frame of the new target genes was connected to the transformation vector. The original restriction enzyme cutting site disappeared after connecting to the isocaudamer. The plant transformation vector p096871, which contained Bacillus thuringiensis (Bt) genes Cry1Ac and Cry3A as well as p09X6, which contained mtlD, strD, betA, nhaA, and ostAB, were constructed using this vector system. Resistant plants were obtained after tobacco was transformed by two vectors via the Agrobacterium-mediated method. Detection by PCR revealed that all exogenous genes were inserted into the genome of tobacco. Real-time fluorescence quantification PCR, reverse transcription PCR, and ELISA detections were performed on five transgenic lines transformed by two Bt genes. Cry1Ac and Cry3A were inserted into the genome with a single copy to transcribe and express Bt toxins. The proposed vector system reduced the number of operational procedures and minimized the difficulty of the experiment.

Silicon modifies both a local response and a systemic response to mechanical stress in tobacco leaves

R. Hajiboland, S. Bahrami-Rad, C. Poschenrieder

Biologia plantarum 61:187-191, 2017 | DOI: 10.1007/s10535-016-0633-3

Both lignin and silicon (Si) are major players in the resistance of plants to mechanical stress (MS). Focusing on the phenolic metabolism, here we studied the short-term effects of a local MS on tobacco (Nicotiana rustica L. cv. Basmas) plants with Si (+Si, 1 mM Na2SiO3) and without Si (‒Si) treatments in order to see how Si may modify local and systemic responses. One week after starting the Si treatment, a half of the plants were exposed to a mechanical pressure applying 980 Pa for 24 h on the upper side of the 3rd leaf of each plant (+MS). The rest of the plants remained unstressed (‒MS). Plants were harvested 24 h and 72 h after starting the MS and the leaves directly exposed to the mechanical stress (DMS) and those indirectly exposed to the mechanical stress (IMS) from below and above the DMS leaf were analyzed for phenolic metabolism along with the corresponding leaves from‒MS plants. In the DMS leaf, the activities of polyphenol oxidase, phenylalanine ammonia lyase, and cytosolic and covalently-bound peroxidases increased by the MS, while decreased by Si. In accordance with this in the DMS leaf, the content of soluble and cell wall-bound phenolics and lignin were enhanced by the MS but decreased by Si. Interestingly, Si influenced the pattern of response to the MS depending on whether the leaves were directly treated by the MS or not. Silicon treatment augmented MS-induced lignin accumulation in the DMS leaf while rather inhibited lignin formation in the IMS leaves. These data show that Si modified MS-mediated changes in the phenolic metabolism differently in local and systemic leaves.

Enhancement of stress tolerance in cucumber seedlings by proanthocyanidins

L.-J. Zhu, X.-G. Deng, L.-J. Zou, D.-W. Zhang, H.-H. Lin

Biologia plantarum 61:323-332, 2017 | DOI: 10.1007/s10535-016-0663-x

Proanthocyanidins (PAs) are the main products of the flavonoid biosynthetic pathway in many plants. However, their biological function during environmental stresses in plants is rarely reported. In the present study, the effects of pretreatment with PAs on the response of cucumber (Cucumis sativus L.) seedlings to high irradiance (HI), polyethylene glycol (PEG), and cold stress were investigated. The PAs pretreament alleviated stress-induced oxidative damage in plant cells and increased the activity of alternative oxidase (AOX) and content of abscisic acid (ABA). Furthermore, PAs-pretreated seedlings suffered less damage by the stress conditions, maintained higher content of chlorophyll a+b and AOX proteins in comparison with the control. Therefore, our findings suggest that PAs might contribute to plant tolerance to environmental stresses.

Selection of reference genes for quantitative real-time PCR in Casuarina equisetifolia under salt stress

C. Fan, Z. Qiu, B. Zeng, Y. Liu, X. Li, G. Guo

Biologia plantarum 61:463-472, 2017 | DOI: 10.1007/s10535-016-0670-y

Real time quantitative PCR (qPCR) is widely used in gene expression analysis for its accuracy and sensitivity. Reference genes serving as endogenous controls are necessary for gene normalization. In order to select an appropriate reference gene to normalize gene expression in Casuarina equisetifolia under salt stress, 10 potential reference genes were evaluated using real time qPCR in the leaves and roots of plants grown under different NaCl concentrations and treatment durations. GeNorm, NormFinder, and BestKeeper analyses reveal that elongation factor 1-alpha (EF1α) and ubiquitin-conjugating enzyme E2 (UBC) were the most appropriate reference genes for real time qPCR under salt stress. However, β-tubulin (βTUB) and actin 7, which were widely used as reference genes in other plant species, were not always stably expressed. The combination of EF1α, UBC, uncharacterized protein 2, DNAJ homolog subfamily A member 2, and glyceraldehyde-3-phosphate dehydrogenase should be ideal reference genes for normalizing gene expression data in all samples under salt stress. It indicates the need for reference gene selection for normalizing gene expression in C. equisetifolia. In addition, the suitability of reference genes selected was confirmed by validating the expression of WRKY29-like and expansin-like B1. The results enable analysis of salt response mechanism and gene expression in C. equisetifolia.

Silicon enhances the tolerance of Poa annua to cadmium by inhibiting its absorption and oxidative stress

P. Li, C. Z. Zhao, Y. Q. Zhand, X. M. Wang, J. F. Wang, F. Wang, Y. R. Bi

Biologia plantarum 61:741-750, 2017 | DOI: 10.1007/s10535-017-0731-x

Silicon (Si) could enhance plant tolerance to heavy metals; however, the mechanism of Si-mediated alleviation of cadmium (Cd) toxicity in Poa annua was not clear. In this study, we found that 100 μM Cd significantly inhibited the growth of Poa annua seedlings. Furthermore, Cd enhanced the H2O2 and malondialdehyde content. The activities of superoxide dismutase and ascorbate peroxidase were enhanced, but the catalase and peroxidase activities were reduced by Cd treatment. Cd also altered the activity and expression of glucose-6-phosphate dehydrogenase (G6PDH) in Poa annua roots. Application of Na3PO4, an inhibitor of G6PDH, decreased the activity of G6PDH, the expression of G6PDH, and increased the Cd toxicity, suggesting that G6PDH is involved in the regulation of oxidative stress induced by Cd. Application of 1 mM Si alleviated the inhibition of Cd on the growth of Poa annua seedlings. Si application not only led to reduced oxidative injuries but also decreased the accumulation of Cd in Poa annua seedlings under Cd stress. Furthermore, Si decreased the activity of G6PDH and the expression of G6PDH under Cd stress, which demonstrated that Si attenuates the Cd toxicity in Poa annua probably through decreasing the expression of G6PDH under Cd stress. When G6PDH was inhibited, the alleviation impact of Si on Cd stress was abolished. Taken together, these results demonstrated that the Cd tolerance in Poa annua enhanced by Si is mainly due to the decrease of Cd uptake in roots and lowering the oxidative stress induced by Cd.

The lignin synthesis related genes and lodging resistance of Fagopyrum esculentum

D. Hu, X. B. Liu, H. Z. She, Z. Gao, R. W. Ruan, D. Q. Wu, Z. L. Yi

Biologia plantarum 61:138-146, 2017 | DOI: 10.1007/s10535-016-0685-4

Lignin is closely related to the lodging resistance of common buckwheat (Fagopyrum esculentum Moench.). However, the characteristics of lignin synthesis related genes have not yet been reported. We investigated the lignin biosynthesis gene expression, activities of related enzymes, and accumulation of lignin monomers during branching stage, bloom stage, and milky ripe stage by real-time quantitative PCR, UVspectrophotometry, and gas chromatography-mass spectrometry in the 2nd internode of three common buckwheat cultivars with different lodging resistance. The results showed that lignin content and the activity of phenylalanine ammonia lyase (PAL), 4-coumarate: CoA ligase (4CL), cinnamyl alcohol dehydrogenase (CAD) and peroxidase (POD) were closely related to the lodging resistance of common buckwheat. Further, we studied gene expression of cinnamate 4-hydroxylase (C4H), caffeoyl-CoA O-methyltransferase (CCoAOMT), ferulate 5-hydroxylase (F5H), cinnamoyl-CoA reductase (CCR), and caffeic acid O-methyltransferase (COMT). The lignin biosynthesis genes were divided into three classes according to their expression pattern: 1) expression firstly increasing and then descending (PAL, 4CL, CAD, C4H, CCoAOMT, F5H, and CCR), 2) expression remaining constant during maturation (C3H), and 3) expression decreasing with maturation (COMT). The present study provides preliminary insights into the expression of lignin biosynthesis genes in common buckwheat, laying a foundation for further understanding the lignin biosynthesis.

The analysis of mutant phenotypes and tissue expression reveals a role of SNAREs VAMP721 and VAMP722 in seedling growth

L. Zhang, H. Y. Zhao, W. C. Qi, F. X. Zheng, T. Q. Wang, J. Y. Li

Biologia plantarum 61:275-283, 2017 | DOI: 10.1007/s10535-017-0745-4

Membrane traffic mediated by a soluble N-ethylmaleimide sensitive factor attachment protein receptor (SNARE) complex contributes to plant growth and development. However, the functional significance of SNAREs involved in cell wall deposition and seedling development has not been sufficiently explored. In this study, we explored the roles of R-SNAREs VAMP721 (At1g04750) and VAMP722 (At2g33120) in seedling growth of Arabidopsis thaliana by histochemical staining, fluorescence labeling, and analyzing mutant phenotypes. Our results show a massive intracellular accumulation of cellulose and callose, and an abnormal deposition of callose at the expanding cell plate in vamp721vamp722 root cells compared with the wild type. Particularly, ectopic lignin accumulation was also observed in vamp721vamp722 root cells. The alteration of cell wall components was confirmed using Fourier transform infrared analysis. Plasma membrane integrity and cell viability were disturbed in the vamp721vamp722 seedling. Morphological observation shows that vamp721vamp722 mutations impaired development of roots, hypocotyl, cotyledon, and true leaf, and inhibited lateral root formation. Confocal images reveal that green fluorescent protein-tagged VAMP721 and VAMP722 showed a similar expression pattern and were expressed throughout all cells and tissues examined, including root and shoot apical meristems and cells of hypocotyls, cotyledons, and true leaves. Taken together, our results suggest that membrane traffic mediated by VAMP721 and VAMP722 is involved in seedling growth in A. thaliana.

Cytosolic GAPDH: a key mediator in redox signal transduction in plants

S. S. Yang, Q. H. Zhai

Biologia plantarum 61:417-426, 2017 | DOI: 10.1007/s10535-017-0706-y

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) serves not only as a key enzyme in glycolysis, but also as a multifunctional protein in other biological processes, especially in response to abiotic stresses in plants. Cytosolic GAPDH (GAPC) is a typical redox protein with selected catalytic cysteine, which undergoes reversible redox post-translational modifications (RPTMs) on its thiol group by reacting with hydrogen peroxide and nitric oxide related species. Moreover, the modified GAPC may interact with certain signal transmitters such as phosphatidic acid, phospholipase D, and osmotic stress-activated protein kinase. All these observations suggest that GAPC serve as a key mediator in redox signal transduction in plants. In this review, we provide an up-to-date insight into molecular mechanisms after H2O2- and NO-dependent oxidation of GAPC. We also discuss GAPC catalytic functions and potential functions as a modified protein by RPTMs.

Foliar-application of α-tocopherol enhanced salt tolerance of Carex leucochlora

Y. R. Ye, W. L. Wang, C. S. Zheng, D. J. Fu, H. W. Liu, X. Shen

Biologia plantarum 61:565-570, 2017 | DOI: 10.1007/s10535-017-0709-8

Several different concentrations of α-tocopherol were applied to Carex leucochlora after plants had been treated with high salinity (0.8 % NaCl) in a greenhouse for one month. The results revealed that 0.8 mM α-tocopherol treatment showed the greatest alleviation of growth inhibition and cell membrane damage induced by salt stress. In comparison with NaCl alone, the 0.8 mM α-tocopherol application significantly decreased the content of hydrogen peroxide and the rate of superoxide radical generation, and increased the content of chlorophyll b, carotenoids, free proline, and soluble protein, but had no effect on the content of chlorophyll a and soluble sugar. These results suggest that α-tocopherol could effectively protect C. leucochlora plants from salt stress damage presumably by quenching the excessive reactive oxygen species to protect the photosynthetic pigments and by enhancing the osmotic adjustment.

 previous    ...   3   4   5   6   7  8   9   10   11   12   ...    next