The cation/H⁺ exchange is a basic process in transmembrane transport. The acquisition of genome sequences has now established that plants possess genes encoding a large number of cation/proton antiporter 1 (CPA1) proteins, few of which have been characterized with respect to their contribution to ion homeostasis. The CPA1s comprise plasma membrane, vacuolar, and endosomal forms, and they have been identified as important for a salinity tolerance. They are, however, also involved in both the control of cellular pH and K⁺ homeostasis, and regulate processes over a wide range of physiological events, from vesicle trafficking to development.

We compared C₃ and CAM (crassulacean acid metabolism) states in Mesembryanthemum crystallinum, a facultative CAM species, with respect to the involvement of phosphoenolpyruvate carboxylase (PEPC) and nitrogen metabolismrelated enzymes in plant response to Botrytis cinerea infection. The enzyme activities were monitored both in pathogeninoculated 2^nd leaf pair and non-inoculated 3^rd leaf pair. The control activities of most studied enzymes were dependent on the mode of photosynthesis. Compared to C₃ plants, those performing CAM exhibited higher PEPC, nitrate reductase (NR), and deaminating glutamate dehydrogenase (NAD-GDH) activities but lower glutamine synthetase (GS) and alanine aminotransferase (ALT) activities. Regardless of the mode of photosynthetic carbon assimilation, the plants responded to infection with enhancement of PEPC and inhibition of NR activities in the inoculated leaves. Whereas the activity of GS remained unaffected, those of all glutamate-yielding enzymes, namely ferredoxin-dependent glutamate synthase (Fd-GOGAT), aspartate aminotransferase (AST), ALT, and aminating glutamate dehydrogenase (NADHGDH) were altered after infection. However, the time-course and extent of the observed changes differed in C₃ and CAM plants. In general, CAM plants responded to infection with an earlier increase in PEPC and Fd-GOGAT activities as well as later inhibition of NR activity. Contrary to C₃ plants, in those performing CAM the activities of PEPC, Fd-GOGAT, NADH-GDH, and AST in the non-inoculated 3^rd leaf pair were similarly influenced by infection as in leaves directly inoculated with the pathogen. This implies that the local infection induced an alteration of carbon/nitrogen status in healthy upper leaves. This reprogramming resulting from changes in PEPC and nitrogen metabolism-related enzymes was C₃- and CAM-specific.

Mitogen-activated protein kinases (MAPKs) are significant components of MAPK cascades, which play versatile roles in different transduction pathways to mediate stress adaptation. However, little information is known about post-transcriptional regulation of MAPK genes in plant under drought stress. MicroRNAs (miRNAs), a class of newly identified, short non-coding RNAs, regulate the expression of target genes in plant growth, development, and stress responses. In order to investigate the mechanism of miRNA regulating MAPK genes in potato, we identified a novel potato miRNA with the sequence CGGCCTTAATAAGATGGTGAAG and named it as stu-miR856 depending on miRNA deep sequencing and bioinformatic analysis. Target prediction indicates that it can bind to the coding sequence region of two potato MAPK-like genes, and cleavage positions of them were also effectively validated by RNA ligase-mediated 5' rapid amplification of cDNA ends assay. In addition, expressional analysis shows that stu-miR856 and its targets exhibited an opposite expression pattern: stu-miR856 expression significantly decreased while its target genes greatly increased in the different stages of drought treatment. The results indicate that a decreased expression of stu-miR856 might drive overexpression of two StMAPK genes family members, which may contribute to regulation of the drought adaptation of potato plants.

Various physiological and biochemical parameters associated with improved salinity tolerance in the transgenic rice lines overexpressing OsCaM1-1 gene and wild-type KDML105 were compared 3 d after exposure to 150 mM NaCl. The results showed higher relative water content, relative growth rate, content of photosynthetic pigments (chlorophylls a, b, and carotenoids), DPPH scavenging activity, and activities of superoxide dismutase, catalase, ascorbate peroxidase, and glutathione reductase in the transgenic plants when compared with the wild-type and control, KDML105 transformed with blank vector, whereas H₂O₂ content, Na/K and Na/Ca ratio, lipid peroxidation, and electrolytic leakage were lower. Taken together, the OsCaM1-1 gene overexpression probably reduced salt-induced oxidative damage in the transgenic plants by enhancing the activities of antioxidant enzymes.

Arabidopsis thaliana L. ecotype Dijon-G (Di-G) showed a different symptom development during pathogenesis compared to ecotype Columbia-0 (Col-0). Previously, it has been shown that Di-G has a higher susceptibility to necrotrophic fungus Alternaria brassicicola than Col-0. In this study, Di-G showed enhanced disease susceptibility to necrotrophic fungi Botrytis cinerea, Sclerotinia sclerotiorum, and Sclerotium rolfsii known to secrete oxalic acid (OA) as a pathogenicity factor. Treatment with 50 and 100 mM OA resulted in a more leaf tissue collapse in Di-G than in Col-0. The OA also up-regulated expression of the salicylic acid (SA)-inducible pathogenesis-related gene 1 (PR1) and down-regulated expression of the jasmonic acid/ethylene-inducible defensin PDF1.2 gene in Di-G. By contrast, Di-G was resistant to hemibiotrophic fungus Colletotrichum higginsianum and biotrophic Turnip crinkle virus (TCV) infections. Application of 0.5 mM SA resulted in a higher accumulation of endogenous SA and in a preferential expression of SA-responsive genes in Di-G. Salicylic acid accelerated OA-triggered plant cell death and attenuated PDF1.2 expression in Di-G. These results suggest that the enhanced susceptibility of Di-G to necrotrophic pathogen infections might be mediated by attenuated JA-ethylene defence signalling and/or heightened SA-related defence signalling. Interaction of SA-signalling with OA secretion might be also involved in the enhanced susceptibility of Di-G.

Calmodulin-binding transcription activators (CAMTAs) play important roles in plant growth, developmental processes, and responses to abiotic and biotic factors. Recently, five CAMTA members were identified in Citrus sinensis, however, very little is known about the molecular regulation of these CAMTAs in citrus during fruit development and under abiotic stresses. In this study, the different expression profiles of CsCAMTA genes were found in different tissues and different fruit developmental stages. The CsCAMTA genes also displayed distinct expression patterns after heat, cold, salt, and drought stresses. Furthermore, the expressions of CsCAMTA genes were significantly induced by treatments with salicylic acid, methyl jasmonate, or abscisic acid. The green fluorescent protein gene fused with CsCAMTA was specifically expressed in the nucleus of Nicotiana benthamiana cells. Additionally, CsCAMTA proteins can activate or suppress DNA transcription in yeast. These findings provide helpful information for further studies of stress signals in citrus.

Plant defensins and defensin like protein (DEFL) form a large family of small cysteine-rich proteins. They are major components of plant immune systems, being involved in host defenses against biotic and abiotic stresses. In this study, a novel defensin like protein (DEFL) gene PnDEFL1 was isolated from Panax notoginseng, a traditional Chinese medicinal herb. The expression patterns of PnDEFL1 after treatment with methyl jasmonate, salicylic acid, ethephon, and H₂O₂, as well as during Fusarium solani infection, were analyzed using reverse transcription qPCR. The up-regulated expression of PnDEFL1 indicated that it responded to F. solani infection and all four defense-related signalling molecules. The PnDEFL1 gene was further fused with the green fluorescent protein gene in a plant expression vector and transformed into onion (Allium cepa) epidermal cells. The laser scanning confocal microscope confirmed that the PnDEFL1 protein localized to the extracellular region. In addition, the recombinant PnDEFL1 protein was expressed in Escherichia coli and purified by affinity chromatography. It had antifungal activities against F. solani, F. oxysporum, Botrosphaeria dothidea, and Sclerotinia sclerotiorum. The PnDEFL1 gene was transferred into tobacco (Nicotiana tabacum) to verify its function. The overexpression of PnDEFL1 in tobacco conferred a high resistance to F. solani infection. Thus, the PnDEFL1 gene is involved in the defense responses of P. notoginseng to F. solani infection.

Several studies revealed the important contribution of calcineurin B-like (CBLs) and CBL-interacting kinase (CIPKs) genes in transmitting stress signals in plants. Taking advantage from the genome sequences of the cultivated potato Solanum tuberosum and its wild relatives S. commersonii and S. chacoense, we identified for the first time 10 CBLs and 26 CIPKs genes in each species. The CBLs and CIPKs derived from tandem duplications indicate that these gene families in potato mainly arise through amplification mechanisms. Once annotated, we compared the par excellence model of Arabidopsis thaliana with S. commersonii, the potato model species for studying cold tolerance. We found that four ScCBL proteins (ScCBL1, ScCBL4a, ScCBL4b, and ScCBL9) started with a conserved N-myristoylation motif (MGXXXS/T), which might function in membrane targeting of the CBLs-CIPKs complex. Additionally, expression analyses of S. commersonii CBL and CIPK genes based on RNAseq revealed diverse expression patterns following various abiotic and biotic stresses and in the four tissues analyzed (flowers, leaf, roots, and tubers). Data also suggest that the ScCBLs-ScCIPKs complex may be more responsive to abiotic rather than biotic stimuli. Overall, the results described in the present work will be useful for future investigations and for functional characterization of individual CBLs and CIPKs in Solanum.

Salsola laricifolia, a typical C₃-C₄ intermediate desert plant, is an important for understanding gene evolution and mechanisms for drought resistance. The reverse transcription quantitative polymerase chain reaction (RT-qPCR) is a preferred choice for gene expression studies, but it requires stable reference genes for normalization. Therefore, we tested the expression stability of five candidate reference genes in S. laricifolia: EF1α (elongation factor 1-α), ACT (actin), GAPDH (glyceraldehyde-3-phosphate dehydrogenase), TUB (tubulin), and 18S (18S ribosomal RNA). The expressions were tested in different tissues and under five stresses caused by abscisic acid (ABA), NaCl, NaHCO₃, darkness, and osmotic stress (polyethylene glycol 6000, PEG). Four commonly used software programs (geNorm, NormFinder, BestKeeper, and RefFinder) were used. The results show the following most stable reference genes: GAPDH for ABA and dark treatments; EF1a for NaCl, PEG; and all samples; TUB for NaHCO₃; and 18S for the controls. The ACT was not ranked first in any group, and was the least stable reference gene under the dark, NaHCO₃, and PEG. Moreover, pairwise analysis by the geNorm algorithm shows that two best reference genes were 18S and EF1a for the controls, GAPDH, and 18S for the ABA and dark treatments, EF1a and TUB for the NaCl treatment, TUB and 18S for the NaHCO₃ treatment, EF1a and GAPDH for the PEG treatment, and EF1a and 18S for all samples. The reference genes for RT-qPCR in S. laricifolia identified in our study will facilitate future work on targeted gene expression.

Osmanthus fragrans Lour., one of the top 10 most popular flowers in China, is known for both its beauty and fragrance. It is rich in flavonoids, a class of secondary metabolites with significant neuroprotective, free-radical scavenging, and anti-oxidant activity. To understand the mechanisms regulating flavonoid biosynthesis, we conducted transcriptome sequencing O. fragrans flowers to analyze gene expressions during the full flowering stage. The RNA was isolated separately from petals of cvs. Yingui and Dangui, which were treated or not with jasmonic acid, salicylic acid, or abscisic acid. A total of 142 029 unigenes were denovo assembled, and 50 918 unigenes were annotated. The differentially expressed genes were identified, annotated, and classified. The results of transcriptome sequencing and real-time PCR revealed higher expressions of phenylalanine ammonia-lyase (PAL), PAL1, chalcone synthase (CHS), flavanone-3-hydroxylase (F3H), flavonol synthase (FLS), and lower expressions of dihydroflavonol-4-reductase (DFR), anthocyanidin synthase (ANS) in 'Yingui' than in 'Dangui'. Such an expression pattern facilitated the higher accumulation of flavonoids in 'Yingui'. Several genes of the flavonoid biosynthesis pathway were upregulated by jasmonic acid and salicylic acid in both the cultivars leading to flavonoid accumulation in their petals. In the v-myb avian myeloblastosis viral oncogene homolog 1(MYB1)-overexpressing petals, the expressions of PAL, PAL1, CHI, and FLS increased. The results suggest that MYB1 may participate in the flavonoid biosynthesis pathway and regulate the expression of some upstream genes in O. fragrans.

Virus-induced gene silencing (VIGS) is a particularly useful tool for functional genomics. In the present study, we attempted to utilize this technology to infer the function of genes from Viola philippica using a tobacco rattle virus (TRV) construct. Firstly, the phytoene desaturase gene from V. philippica (VpPDS) was silenced, and local leaf bleaching was observed but did not exhibit systemic effects, thereby limiting utilization of TRV-mediated gene silencing in the recipient plant. However, we observed systemic gene silencing in Nicotiana benthamiana when the VpPDS sequence was used as a trigger, thereby suggesting that heterologous gene sequences could elicit gene silencing. We then investigated the role of gene PISTILLATA from V. philippica (VpPI) of the B-class MADS-box gene family, which regulates the identity and development of stamens and petals. Using the coding region of VpPI as triggers, we determined the gene silencing efficiency of the corresponding GLOBOSA paralogs in N. benthamiana (NbGLO1 and NbGLO2), and we observed stamen-to-carpel transformation and distorted corollas in N. benthamiana suggesting that VpPI functioned as the NbGLO gene. However, the 3'-untranslated region (3'UTR) of VpPI and each 3'UTR of the NbGLO genes downregulated its own corresponding gene, hardly producing floral homeotic alterations. This work provides a better understanding of gene-specific probe design for gene silencing as well as shows that heterologous sequence-triggered VIGS is an efficient way to investigate functional conservation of orthologous genes.

Waterlogging, a major environmental stress, impairs plant growth and development and induces synthesis of different proteins. To understand the molecular mechanisms coupled with morpho-physiological alterations underlying waterlogging tolerance, the LTQ-FTICR MS/MS technique was employed to map the proteomes of leaves of sesame grown under control and waterlogged conditions. The waterlogging treatment caused dramatic alterations in morphological and biochemical properties of the leaves of sesame. For proteome analysis, more than 75 reproducible protein spots were identified on 2-DE gels wherein 51 protein spots (≥ 1.5-fold change) were used for analysis by mass spectrometry. Among 51 differentially abundant proteins, 20 were specific to the 10-leaf stage and 31 were specific to the flowering stage. Most of the differentially abundant proteins were involved in group metabolism, and energy and stress defense. Oxygen-evolving enhancer protein 1, ATP synthase subunit, heat shock proteins, glutamine synthetase, glyceraldehyde-3-phosphate dehydrogenase, and superoxide dismutase were upregulated under waterlogging. However, the photosynthesis- and protein biosynthesis-related proteins (e.g., ribulose-1,5-bisphosphate carboxylase/oxygenase activase, and S-adenosylmethionine synthase 1) were down-regulated under waterlogging. The protein interaction network indicates that energy metabolism- and stress- and defense-related proteins were involved in the protein-protein interaction network, which could form an indispensable network in sesame leaves. To this end, physiological results highlighted the impairment of photosyntheis, which is consistent with results obtained at the proteome level. The upregulation of metabolism-, energy-, and stress defense-related proteins in response to waterlogging stress may provide new insights into the complex mechanisms underlying waterlogging tolerance in sesame.

Strawberry tree (Arbutus unedo) is a small perennial tree that grows spontaneously in the Mediterranean basin, Ireland, and Portugal. In this work, strawberry tree clones were established in vitro from epicormic shoots obtained from a young tree, an adult tree, and from a seedling. They were propagated by axillary shoot buds proliferation on solid and in liquid media, and also in a modified De Fossard medium with 9 µM benzylaminopurine. The organogenesis from calli obtained from apical leaves of the in vitro grown shoots from the three genotypes was carried out in the same basal liquid medium supplemented with 9 µM thidiazuron. Micropropagation through organogenesis in liquid medium proved to be more efficient than the other tested methods (considering the number of shoots produced), but the shoots were showing hyperhydricity. Shoots were sucessufully rooted on medium with indole-3-butyric acid and acclimatized ex vitro with rates higher than 90 %. Six month-old plants from the most proliferative genotype (AU1) and propagated in vitro by different methods were submitted to drought stress (no watering for 10 d) and several morphological and physiological parameters were evaluated and compared to a control group (watered to 70 % field capacity). No significant differences were found in plant biomass, root length, and plant height, however, slight differences were observed in water potential, net photosynthetic rate, intercellular CO₂ concentration, and stomatal conductance between the plantlets propagated on solid or liquid medium. In general, the responses to drought stress imposed were was similar in plants micropropagated by different propagation methods.

In non-heading Chinese cabbage, the yield relies mostly on the health of leaves, which can be heavily impacted by turnip mosaic virus (TuMV). The virions or viral ribonucleoprotein complexes are transported through the phloem and xylem. Plasmodesmata are indispensable because they traverse cell walls and connect companion cells, allowing virus particles long distance movement. However, which complexes and genes participate in this process is still unknown. Plants can activate defense mechanisms and apply disease resistance genes to respond to pathogen attacks. In this study, we collected the stems and petioles infected by TuMV for 7 d (TuMV-7), 14 d (TuMV-14), and 21 d (TuMV-21). Using isobaric tags for relative and absolute quantification-based proteomic technology, 6 043 distinct proteins were identified and 323, 240, 285, 203, 253, and 363 differentially expressed proteins were found in the comparable pairs of TuMV-7/control, TuMV-14/TuMV-7, TuMV-14/control, TuMV-21/TuMV-7, TuMV-21/TuMV-14, and TuMV-21/control, respectively. We performed a functional annotation analysis of all identified proteins and a functional enrichment analysis of all differentially expressed proteins. The results indicated that the long distance movement of TuMV involved many complex regulatory pathways. The respective proteins were related to those occurring in plasmodesmata and to Ca²⁺ transporters. Further, we also found proteins related to heat shock proteins, pathogenesis-related proteins, and proteins scavenging reactive oxygen species.

Superoxide dismutase is a crucial reactive oxygen species (ROS) scavenger and converts the superoxide radical (O₂^-) to H₂O₂, so it is thought to enhance abiotic stress tolerance by reducing ROS accumulation and so avoiding oxidative damage. In this study, we isolated a salt- and oxidative stress-responsive Cu/Zn SOD gene TaSOD5 from wheat. The ectopic overexpression of TaSOD5 in Arabidopsis increased total and Cu/Zn SOD activities, and offered the plant tolerance to salt stress. Arabidopsis ectopically expressing TaSOD5 possessed a superior resistance to oxidative stress induced H₂O₂. The TaSOD5 ectopic overexpression elevated the activities of both ROS scavengers and O₂^- producer NADPH oxidase. These findings show that Cu/Zn SOD enhances salt tolerance via regulating the machinery of redox homeostasis rather than improving SOD activity alone.

Salinity adversely affects plants resulting in disruption to plant growth and physiology. Previously, it has been shown that these negative effects can be alleviated by various exogenous polyamines. However, the role of spermidine (Spd) in conferring salinity tolerance in sorghum is not well documented. The effect of exogenous Spd on the responses of sweet sorghum (Sorghum bicolor L.) seedlings to salt stress (150 mM NaCl) was investigated by measuring photosynthetic carbon assimilation, Calvin cycle enzyme activities, and the the expression of respective genes. Application of 0.25 mM Spd alleviated the negative effects of salt stress on efficiency of photosystem II and CO₂ assimilation and increased the activities of ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco) and aldolase. Salt stress significantly lowered the transcriptions of genes encoding Rubisco large subunit, Rubisco small subunit, 3-phosphoglyceric acid kinase, glyceraldehyde-3-phosphate dehydrogenase, triose-3-phosphate isomerase, fructose-1,6-bisphosphate aldolase, fructose-1,6-bisphosphate phosphatase, and sedoheptulose-1,7-bisphosphatase. However, transcriptions of genes encoding phosphoribokinase and Rubisco were up-regulated. The Spd application enhanced expressions of most of these genes. It appears Spd conferred salinity tolerance to sweet sorghum seedlings by enhancing photosynthetic efficiency through regulation of gene expressions and activities of key CO₂ assimilation enzymes.

Plant hormones play important roles in seed dormancy and dormancy breaking. We measured the hormone content in rice (Oryza sativa L. cv. Nona Bokra) seeds at different stages and with or without imbibition treatment. We identified 1 265 differentially expressed genes (DEGs) between dormant and dormancy-broken seeds using RNA-seq analysis: 1 015 genes were significantly up-regulated, while 250 genes were significantly down-regulated. Sixteen DEGs were selected as related to seed dormancy, and their expressions were validated using quantitative PCR. Three DEGs were in the same position as two reported dormancy QTLs, suggesting that they may be candidate genes that control the dormancy of rice seeds. Our study provides an important basis for cloning genes in dormant rice seeds and provides theoretical support for the study of the dormancy mechanism.

The roles of ethylene responsive factors (ERFs) and their positive and negative regulations of abiotic stress tolerance have been widely reported. This study reports the characterization of ItERF from Iris typhifolia Kitag with respect to molecular and functional properties. The 867 bp cDNA fragment of ItERF was cloned by reverse transcription PCR from I. typhifolia. Real-time quantitative PCR revealed that ItERF expression was induced in the roots, stems, and leaves of I. typhifolia after NaCl treatment, and that ItERF expressions were significantly higher in the leaves and roots than in the stems. A green fluorescent protein marker revealed that ItERF was located to the nucleus. Plant survival and root growth of ItERF transgenic Arabidopsis thaliana L. seedlings were much better than those of the wild type under NaCl stress. Malondialdehyde content in the transgenic lines was significantly lower than that in the wild type. Growth of yeast transformants showed an enhanced tolerance to salt stress than non-transformed yeast cells. All of the results verified that the expression of ItERF had effects on plant growth under salt stress.

Gibberellic acid (GA₃) is widely used at different stages of berry development, and to understand the molecular mechanism of its action requires identification of stable reference genes. We sprayed grapevine (Vitis vinifera L.) cv. Thompson Seedless with GA₃ at rachis stage for rachis elongation, at flower cluster stage for flower thinning, and at 3-4 mm berry stage for berry elongation. Tissue samples were collected at different time points after GA₃ application. The expression of 10 candidate reference genes was analyzed using 4 different algorithms to assess their suitability for real time-PCR data normalization. Based on the overall ranking, PP2A, Sutra, and SAND were identified as the most stably expressed genes across all samples. With regard to different stages, tubulin, EF1α, and UBC were the most stable genes during rachis elongation; PP2A, SAND, and Sutra were the most suitable at the flower cluster and berry stages. The expression of GA signaling gene SPINDLY (VvSpy) was analyzed to validate the stable reference genes. After the GA₃ application, the expression of VvSpy was reduced at the rachis stage but did not change at the flower cluster and berry stages. The expression profile of VvSpy was comparable when two or three reference genes were used for data normalization.

A plasmid and two isocaudamer systems, namely, NotI/Bsp120I and SpeI/XbaI/NheI, were used to construct a new type of multi-gene plant transformation vector system. This system included a transformation vector containing the restriction enzyme cutting sites Bsp120I and XbaI as well as a cloning vector containing the restriction enzyme cutting sites NotI, Bsp120I, SpeI, and NheI. The open reading frame of the new target genes was connected to the transformation vector. The original restriction enzyme cutting site disappeared after connecting to the isocaudamer. The plant transformation vector p096871, which contained Bacillus thuringiensis (Bt) genes Cry1Ac and Cry3A as well as p09X6, which contained mtlD, strD, betA, nhaA, and ostAB, were constructed using this vector system. Resistant plants were obtained after tobacco was transformed by two vectors via the Agrobacterium-mediated method. Detection by PCR revealed that all exogenous genes were inserted into the genome of tobacco. Real-time fluorescence quantification PCR, reverse transcription PCR, and ELISA detections were performed on five transgenic lines transformed by two Bt genes. Cry1Ac and Cry3A were inserted into the genome with a single copy to transcribe and express Bt toxins. The proposed vector system reduced the number of operational procedures and minimized the difficulty of the experiment.

Both lignin and silicon (Si) are major players in the resistance of plants to mechanical stress (MS). Focusing on the phenolic metabolism, here we studied the short-term effects of a local MS on tobacco (Nicotiana rustica L. cv. Basmas) plants with Si (+Si, 1 mM Na₂SiO₃) and without Si (‒Si) treatments in order to see how Si may modify local and systemic responses. One week after starting the Si treatment, a half of the plants were exposed to a mechanical pressure applying 980 Pa for 24 h on the upper side of the 3^rd leaf of each plant (+MS). The rest of the plants remained unstressed (‒MS). Plants were harvested 24 h and 72 h after starting the MS and the leaves directly exposed to the mechanical stress (DMS) and those indirectly exposed to the mechanical stress (IMS) from below and above the DMS leaf were analyzed for phenolic metabolism along with the corresponding leaves from‒MS plants. In the DMS leaf, the activities of polyphenol oxidase, phenylalanine ammonia lyase, and cytosolic and covalently-bound peroxidases increased by the MS, while decreased by Si. In accordance with this in the DMS leaf, the content of soluble and cell wall-bound phenolics and lignin were enhanced by the MS but decreased by Si. Interestingly, Si influenced the pattern of response to the MS depending on whether the leaves were directly treated by the MS or not. Silicon treatment augmented MS-induced lignin accumulation in the DMS leaf while rather inhibited lignin formation in the IMS leaves. These data show that Si modified MS-mediated changes in the phenolic metabolism differently in local and systemic leaves.

Proanthocyanidins (PAs) are the main products of the flavonoid biosynthetic pathway in many plants. However, their biological function during environmental stresses in plants is rarely reported. In the present study, the effects of pretreatment with PAs on the response of cucumber (Cucumis sativus L.) seedlings to high irradiance (HI), polyethylene glycol (PEG), and cold stress were investigated. The PAs pretreament alleviated stress-induced oxidative damage in plant cells and increased the activity of alternative oxidase (AOX) and content of abscisic acid (ABA). Furthermore, PAs-pretreated seedlings suffered less damage by the stress conditions, maintained higher content of chlorophyll a+b and AOX proteins in comparison with the control. Therefore, our findings suggest that PAs might contribute to plant tolerance to environmental stresses.

Real time quantitative PCR (qPCR) is widely used in gene expression analysis for its accuracy and sensitivity. Reference genes serving as endogenous controls are necessary for gene normalization. In order to select an appropriate reference gene to normalize gene expression in Casuarina equisetifolia under salt stress, 10 potential reference genes were evaluated using real time qPCR in the leaves and roots of plants grown under different NaCl concentrations and treatment durations. GeNorm, NormFinder, and BestKeeper analyses reveal that elongation factor 1-alpha (EF1α) and ubiquitin-conjugating enzyme E2 (UBC) were the most appropriate reference genes for real time qPCR under salt stress. However, β-tubulin (βTUB) and actin 7, which were widely used as reference genes in other plant species, were not always stably expressed. The combination of EF1α, UBC, uncharacterized protein 2, DNAJ homolog subfamily A member 2, and glyceraldehyde-3-phosphate dehydrogenase should be ideal reference genes for normalizing gene expression data in all samples under salt stress. It indicates the need for reference gene selection for normalizing gene expression in C. equisetifolia. In addition, the suitability of reference genes selected was confirmed by validating the expression of WRKY29-like and expansin-like B1. The results enable analysis of salt response mechanism and gene expression in C. equisetifolia.

Silicon (Si) could enhance plant tolerance to heavy metals; however, the mechanism of Si-mediated alleviation of cadmium (Cd) toxicity in Poa annua was not clear. In this study, we found that 100 μM Cd significantly inhibited the growth of Poa annua seedlings. Furthermore, Cd enhanced the H₂O₂ and malondialdehyde content. The activities of superoxide dismutase and ascorbate peroxidase were enhanced, but the catalase and peroxidase activities were reduced by Cd treatment. Cd also altered the activity and expression of glucose-6-phosphate dehydrogenase (G6PDH) in Poa annua roots. Application of Na₃PO₄, an inhibitor of G6PDH, decreased the activity of G6PDH, the expression of G6PDH, and increased the Cd toxicity, suggesting that G6PDH is involved in the regulation of oxidative stress induced by Cd. Application of 1 mM Si alleviated the inhibition of Cd on the growth of Poa annua seedlings. Si application not only led to reduced oxidative injuries but also decreased the accumulation of Cd in Poa annua seedlings under Cd stress. Furthermore, Si decreased the activity of G6PDH and the expression of G6PDH under Cd stress, which demonstrated that Si attenuates the Cd toxicity in Poa annua probably through decreasing the expression of G6PDH under Cd stress. When G6PDH was inhibited, the alleviation impact of Si on Cd stress was abolished. Taken together, these results demonstrated that the Cd tolerance in Poa annua enhanced by Si is mainly due to the decrease of Cd uptake in roots and lowering the oxidative stress induced by Cd.

Phylogenetic analysis has become a common step in characterization of gene and protein sequences. However, despite the availability of numerous affordable and more-or-less intuitive software tools, construction of biologically relevant, informative phylogenetic trees remains a process involving several critical steps that are inherently non-algorithmic, i.e., dependent on decisions made by the user. These steps involve, but are not limited to, setting the aims of the phylogenetic study, choosing sequences to be analyzed, and selecting methods employed in sequence alignment construction, as well as algorithms and parameters used to construct the actual phylogenetic tree. This review aims towards providing guidance for these decisions, as well as illustrating common pitfalls and problems occurring during phylogenetic analysis of plant gene sequences.

Lignin is closely related to the lodging resistance of common buckwheat (Fagopyrum esculentum Moench.). However, the characteristics of lignin synthesis related genes have not yet been reported. We investigated the lignin biosynthesis gene expression, activities of related enzymes, and accumulation of lignin monomers during branching stage, bloom stage, and milky ripe stage by real-time quantitative PCR, UVspectrophotometry, and gas chromatography-mass spectrometry in the 2^nd internode of three common buckwheat cultivars with different lodging resistance. The results showed that lignin content and the activity of phenylalanine ammonia lyase (PAL), 4-coumarate: CoA ligase (4CL), cinnamyl alcohol dehydrogenase (CAD) and peroxidase (POD) were closely related to the lodging resistance of common buckwheat. Further, we studied gene expression of cinnamate 4-hydroxylase (C4H), caffeoyl-CoA O-methyltransferase (CCoAOMT), ferulate 5-hydroxylase (F5H), cinnamoyl-CoA reductase (CCR), and caffeic acid O-methyltransferase (COMT). The lignin biosynthesis genes were divided into three classes according to their expression pattern: 1) expression firstly increasing and then descending (PAL, 4CL, CAD, C4H, CCoAOMT, F5H, and CCR), 2) expression remaining constant during maturation (C3H), and 3) expression decreasing with maturation (COMT). The present study provides preliminary insights into the expression of lignin biosynthesis genes in common buckwheat, laying a foundation for further understanding the lignin biosynthesis.

Membrane traffic mediated by a soluble N-ethylmaleimide sensitive factor attachment protein receptor (SNARE) complex contributes to plant growth and development. However, the functional significance of SNAREs involved in cell wall deposition and seedling development has not been sufficiently explored. In this study, we explored the roles of R-SNAREs VAMP721 (At1g04750) and VAMP722 (At2g33120) in seedling growth of Arabidopsis thaliana by histochemical staining, fluorescence labeling, and analyzing mutant phenotypes. Our results show a massive intracellular accumulation of cellulose and callose, and an abnormal deposition of callose at the expanding cell plate in vamp721vamp722 root cells compared with the wild type. Particularly, ectopic lignin accumulation was also observed in vamp721vamp722 root cells. The alteration of cell wall components was confirmed using Fourier transform infrared analysis. Plasma membrane integrity and cell viability were disturbed in the vamp721vamp722 seedling. Morphological observation shows that vamp721vamp722 mutations impaired development of roots, hypocotyl, cotyledon, and true leaf, and inhibited lateral root formation. Confocal images reveal that green fluorescent protein-tagged VAMP721 and VAMP722 showed a similar expression pattern and were expressed throughout all cells and tissues examined, including root and shoot apical meristems and cells of hypocotyls, cotyledons, and true leaves. Taken together, our results suggest that membrane traffic mediated by VAMP721 and VAMP722 is involved in seedling growth in A. thaliana.

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) serves not only as a key enzyme in glycolysis, but also as a multifunctional protein in other biological processes, especially in response to abiotic stresses in plants. Cytosolic GAPDH (GAPC) is a typical redox protein with selected catalytic cysteine, which undergoes reversible redox post-translational modifications (RPTMs) on its thiol group by reacting with hydrogen peroxide and nitric oxide related species. Moreover, the modified GAPC may interact with certain signal transmitters such as phosphatidic acid, phospholipase D, and osmotic stress-activated protein kinase. All these observations suggest that GAPC serve as a key mediator in redox signal transduction in plants. In this review, we provide an up-to-date insight into molecular mechanisms after H₂O₂- and NO-dependent oxidation of GAPC. We also discuss GAPC catalytic functions and potential functions as a modified protein by RPTMs.

Several different concentrations of α-tocopherol were applied to Carex leucochlora after plants had been treated with high salinity (0.8 % NaCl) in a greenhouse for one month. The results revealed that 0.8 mM α-tocopherol treatment showed the greatest alleviation of growth inhibition and cell membrane damage induced by salt stress. In comparison with NaCl alone, the 0.8 mM α-tocopherol application significantly decreased the content of hydrogen peroxide and the rate of superoxide radical generation, and increased the content of chlorophyll b, carotenoids, free proline, and soluble protein, but had no effect on the content of chlorophyll a and soluble sugar. These results suggest that α-tocopherol could effectively protect C. leucochlora plants from salt stress damage presumably by quenching the excessive reactive oxygen species to protect the photosynthetic pigments and by enhancing the osmotic adjustment.

The current research was carried out to reveal the possible impacts of cold plasma on growth and physiology of wheat, as a new approach in plant science. Short and long-term impacts of different types of plasma (nitrogen and helium) with surface power density of 0.4 W cm^-2, exposure times (15, 30, 60, and 120 s), and repetitions (1, 2, and 4 times with 24 h intervals) were evaluated. Single-time applied helium or nitrogen derived plasma significantly promoted total root and shoot lengths, in contrast to four times application, and the root system was more sensitive than the shoot one. In addition, seedlings were more sensitive to nitrogen derived plasma, compared with helium. The physiological responses to plasma treatment were analyzed via protein assay and peroxidase or phenylalanine ammonia lyase (PAL) activities measurements. Plasma generated signaling molecules, especially ozone, nitric oxide, and/or UV radiation induced promotions in the peroxidase and PAL activities as well as increase in protein content in leaves, especially when times and/or repetitions increased. Plants were perished by the nitrogen derived plasma at the highest exposure time and number of repetitions. However, the seedlings with inhibited growth not only caught up control one month after, but even the growth rate and biomass accumulation in the shoot and leaves were accelerated. Increased leaf soluble phenol content was recorded in plasma treated seedlings, especially at longer times and more repetitions.