biologia plantarum

International journal on Plant Life established by Bohumil Nìmec in 1959

Fulltext search in archive



« advanced mode »

 previous    ...   3   4   5   6   7  8   9   10   11   12   ...    next 

Results 181 to 210 of 6171:

The RNA-seq transcriptome analysis identified genes related to rice seed dormancy

K. Xie, J. Bai, Y.Y. Yang, N.B. Duan, Y.M. Ma, T. Guo, F.Y. Yao, H.F. Ding

Biologia plantarum 63:308-313, 2019 | DOI: 10.32615/bp.2019.035


Plant hormones play important roles in seed dormancy and dormancy breaking. We measured the hormone content in rice (Oryza sativa L. cv. Nona Bokra) seeds at different stages and with or without imbibition treatment. We identified 1 265 differentially expressed genes (DEGs) between dormant and dormancy-broken seeds using RNA-seq analysis: 1 015 genes were significantly up-regulated, while 250 genes were significantly down-regulated. Sixteen DEGs were selected as related to seed dormancy, and their expressions were validated using quantitative PCR. Three DEGs were in the same position as two reported dormancy QTLs, suggesting that they may be candidate genes that control the dormancy of rice seeds. Our study provides an important basis for cloning genes in dormant rice seeds and provides theoretical support for the study of the dormancy mechanism.

Genome-wide identification of circular RNAs in tomato seeds in response to high temperature

R. Zhou, X.Q. Yu, L.P. Xu, Y.L. Wang, L.P. Zhao, T.M. Zhao, W.G. Yu

Biologia plantarum 63:97-103, 2019 | DOI: 10.32615/bp.2019.012

Circular RNAs (circRNAs), an emerging class of non-coding RNAs, are abundant in eukaryotic transcriptomes. Seed germination is one of the most important stages in the entire life cycle of plants that can be slowed down or totally restrained by high temperature. Our aim is to identify heat-responsive circRNAs and explore the potential function of circRNAs in tomato seeds at high temperature. Following high-throughput sequencing, 4 164 circRNAs were identified, and 980 circRNAs were shared in the control and high-temperature libraries. Among the 748 circRNAs with high expressions, 73 circRNAs were significantly up-/down- regulated in tomato seeds germinated at high temperature compared to the control. The parental genes of circRNAs existing in seeds only at high temperature were mainly involved in metabolic processes, cellular processes, catalytic activities, and binding based on Gene Ontology analysis. The results suggested that circRNAs were widespread in tomato and were generated from different chromosomes and diverse genomic regions. Some circRNAs in tomato seeds responded to high temperature during germination. This study provides the first genome-wide profile of circRNAs in response to high temperature during tomato seed germination and lays a foundation for studying the potential biological functions of circRNAs responding to heat stress.

An overexpression of the AP2/ERF transcription factor from Iris typhifolia in Arabidopsis thaliana confers tolerance to salt stress

J. WU, J. ZHANG, X. LI, J. LIU, Z. NIU, L. WANG*

Biologia plantarum 63:776-784, 2019 | DOI: 10.32615/bp.2019.082

The roles of ethylene responsive factors (ERFs) and their positive and negative regulations of abiotic stress tolerance have been widely reported. This study reports the characterization of ItERF from Iris typhifolia Kitag with respect to molecular and functional properties. The 867 bp cDNA fragment of ItERF was cloned by reverse transcription PCR from I. typhifolia. Real-time quantitative PCR revealed that ItERF expression was induced in the roots, stems, and leaves of I. typhifolia after NaCl treatment, and that ItERF expressions were significantly higher in the leaves and roots than in the stems. A green fluorescent protein marker revealed that ItERF was located to the nucleus. Plant survival and root growth of ItERF transgenic Arabidopsis thaliana L. seedlings were much better than those of the wild type under NaCl stress. Malondialdehyde content in the transgenic lines was significantly lower than that in the wild type. Growth of yeast transformants showed an enhanced tolerance to salt stress than non-transformed yeast cells. All of the results verified that the expression of ItERF had effects on plant growth under salt stress.

Exogenous spermidine enhances expression of Calvin cycle genes andphotosynthetic efficiency in sweet sorghum seedlings under salt stress

A.I. EL SAYED, M.A.M. EL-HAMAHMY, M.S. RAFUDEEN, M.K.H. EBRAHIM

Biologia plantarum 63:511-518, 2019 | DOI: 10.32615/bp.2019.046

Salinity adversely affects plants resulting in disruption to plant growth and physiology. Previously, it has been shown that these negative effects can be alleviated by various exogenous polyamines. However, the role of spermidine (Spd) in conferring salinity tolerance in sorghum is not well documented. The effect of exogenous Spd on the responses of sweet sorghum (Sorghum bicolor L.) seedlings to salt stress (150 mM NaCl) was investigated by measuring photosynthetic carbon assimilation, Calvin cycle enzyme activities, and the the expression of respective genes. Application of 0.25 mM Spd alleviated the negative effects of salt stress on efficiency of photosystem II and CO2 assimilation and increased the activities of ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco) and aldolase. Salt stress significantly lowered the transcriptions of genes encoding Rubisco large subunit, Rubisco small subunit, 3-phosphoglyceric acid kinase, glyceraldehyde-3-phosphate dehydrogenase, triose-3-phosphate isomerase, fructose-1,6-bisphosphate aldolase, fructose-1,6-bisphosphate phosphatase, and sedoheptulose-1,7-bisphosphatase. However, transcriptions of genes encoding phosphoribokinase and Rubisco were up-regulated. The Spd application enhanced expressions of most of these genes. It appears Spd conferred salinity tolerance to sweet sorghum seedlings by enhancing photosynthetic efficiency through regulation of gene expressions and activities of key CO2 assimilation enzymes.

Differential expressions of citrus CAMTAs during fruit development and responses to abiotic stresses

Z.G. Ouyang, L.F. Mi, H.H. Duan, W. Hu, J.M. Chen, T. Peng, B.L. Zhong

Biologia plantarum 63:354-364, 2019 | DOI: 10.32615/bp.2019.041


Calmodulin-binding transcription activators (CAMTAs) play important roles in plant growth, developmental processes, and responses to abiotic and biotic factors. Recently, five CAMTA members were identified in Citrus sinensis, however, very little is known about the molecular regulation of these CAMTAs in citrus during fruit development and under abiotic stresses. In this study, the different expression profiles of CsCAMTA genes were found in different tissues and different fruit developmental stages. The CsCAMTA genes also displayed distinct expression patterns after heat, cold, salt, and drought stresses. Furthermore, the expressions of CsCAMTA genes were significantly induced by treatments with salicylic acid, methyl jasmonate, or abscisic acid. The green fluorescent protein gene fused with CsCAMTA was specifically expressed in the nucleus of Nicotiana benthamiana cells. Additionally, CsCAMTA proteins can activate or suppress DNA transcription in yeast. These findings provide helpful information for further studies of stress signals in citrus.

Proteomic analysis provides integrated insight into mechanisms of Turnip mosaic virus long distance movement in Brassica rapa

C. Liu, G.-S. Sun, R.-J. Zhang, S.-W. Lv, L. Gao, L.-W. Gao, T.-K. Liu, D. Xiao, X.-L. Hou, C.-W. Zhang

Biologia plantarum 63:164-173, 2019 | DOI: 10.32615/bp.2019.019

In non-heading Chinese cabbage, the yield relies mostly on the health of leaves, which can be heavily impacted by turnip mosaic virus (TuMV). The virions or viral ribonucleoprotein complexes are transported through the phloem and xylem. Plasmodesmata are indispensable because they traverse cell walls and connect companion cells, allowing virus particles long distance movement. However, which complexes and genes participate in this process is still unknown. Plants can activate defense mechanisms and apply disease resistance genes to respond to pathogen attacks. In this study, we collected the stems and petioles infected by TuMV for 7 d (TuMV-7), 14 d (TuMV-14), and 21 d (TuMV-21). Using isobaric tags for relative and absolute quantification-based proteomic technology, 6 043 distinct proteins were identified and 323, 240, 285, 203, 253, and 363 differentially expressed proteins were found in the comparable pairs of TuMV-7/control, TuMV-14/TuMV-7, TuMV-14/control, TuMV-21/TuMV-7, TuMV-21/TuMV-14, and TuMV-21/control, respectively. We performed a functional annotation analysis of all identified proteins and a functional enrichment analysis of all differentially expressed proteins. The results indicated that the long distance movement of TuMV involved many complex regulatory pathways. The respective proteins were related to those occurring in plasmodesmata and to Ca2+ transporters. Further, we also found proteins related to heat shock proteins, pathogenesis-related proteins, and proteins scavenging reactive oxygen species.

Promoter activity of genes encoding the Specific Tissue protein family in the reproductive organs of Medicago truncatula

L. ALBORNOS, I. MARTÍN, E. LABRADOR*, B. DOPICO

Biologia plantarum 63:785-796, 2019 | DOI: 10.32615/bp.2019.111

The "Specific Tissue" (ST) are proteins of unknown function present only in some plant families, mainly Fabaceae and Asteraceae. They are included in the PF10950 protein family and characterized by the presence of at least one domain of unknown function (DUF)2775. In this work we studied the involvement of the six members of the Medicago truncatula ST family (ST1 to ST6) in the development of flowers, fruits, and seeds by analysing the activity of their promoters (pST) after the construction of M. truncatula transgenic plants expressing the b-glucuronidase (GUS) reporter gene under the control of the six pSTs. The GUS activity was analysed in whole flowers and fruits and also in histological sections of these organs. The pST expression in the reproductive organs was mainly associated with the vascular bundles, especially throughout fruit development. These results pointed to an important role of ST proteins during the reproductive development stage, related to nutrient mobilization during the fruit and seed formation, that could be facilitated by their presence in the pod vascular bundles, as well as in the connective tissue of the anthers (ST3, ST4, ST6), in the placenta, the funiculus, and the outer parts of the developing seed (ST2, ST3, ST6). The observations made in this study were in agreement with the functions previously established for the three groups of M. truncatula ST proteins, as in the proposed function for ST1 in the transport and assimilation of nutrients, or the involvement of ST4, ST5, and ST6 in floral defence.

A novel potato microRNA stu-miR856 regulates mitogen-activatedprotein kinase genes contributing to drought tolerance

J.W. YANG, X. ZHU, S.G. LI, X. TANG, N. ZHANG, H.J. SI

Biologia plantarum 63:618-626, 2019 | DOI: 10.32615/bp.2019.067

Mitogen-activated protein kinases (MAPKs) are significant components of MAPK cascades, which play versatile roles in different transduction pathways to mediate stress adaptation. However, little information is known about post-transcriptional regulation of MAPK genes in plant under drought stress. MicroRNAs (miRNAs), a class of newly identified, short non-coding RNAs, regulate the expression of target genes in plant growth, development, and stress responses. In order to investigate the mechanism of miRNA regulating MAPK genes in potato, we identified a novel potato miRNA with the sequence CGGCCTTAATAAGATGGTGAAG and named it as stu-miR856 depending on miRNA deep sequencing and bioinformatic analysis. Target prediction indicates that it can bind to the coding sequence region of two potato MAPK-like genes, and cleavage positions of them were also effectively validated by RNA ligase-mediated 5' rapid amplification of cDNA ends assay. In addition, expressional analysis shows that stu-miR856 and its targets exhibited an opposite expression pattern: stu-miR856 expression significantly decreased while its target genes greatly increased in the different stages of drought treatment. The results indicate that a decreased expression of stu-miR856 might drive overexpression of two StMAPK genes family members, which may contribute to regulation of the drought adaptation of potato plants.

MicroRNA319 family members play an important role in Solanum habrochaites and S. lycopersicum responses to chilling and heat stresses

X.P. Shi, F.L. Jiang, J.Q. Wen, S.Y. Cui, Y.Z. Zhou, Z. Wu

Biologia plantarum 63:200-209, 2019 | DOI: 10.32615/bp.2019.023

The microRNA319 (miR319) family is involved in plant development and responses to abiotic stresses. Previous work showed that miR319 responded to chilling stress in the chilling-tolerant wild tomato (Solanum habrochaites L.) genotype LA1777. Here, the precursors of sha-miR319a, b, c, and d were cloned from LA1777 and the putative target genes tosinte branched/cycloidea/proliferating cell factors (TCP3 and TCP29) were validated using 5′-RLM-RACE. Expression patterns revealed a negative correlation of sha-miR319 with TCP3 and TCP29 in LA1777. Four tomato (S. lycopersicum) genotypes with varying sensitivities to chilling and heat stresses were selected to characterize expression patterns of miR319 and target genes under extreme temperatures. The involvement of miR319 in the chilling tolerance of tomato might be mediated by the repression of TCP3 and TCP29 expression. Initial stages of heat stress resulted in the up-regulation of miR319a, b, and d and led to a decrease in TCP3, TCP29, and TCP2 expression, whereas the down-regulation of miR319c in the later stages of heat stress may have been responsible for the subsequent up-regulation of TCP3, TCP29, and TCP2. Cis-elements found in the promoter regions of the miR319 family members indicated a potential role of miR319 in the regulation of stress tolerance and development processes. This study provides insights into the role of miR319-mediated regulatory mechanisms in responses to temperature stress in tomato genotypes.

A methyl jasmonate induced defensin like protein from Panax notoginseng confers resistance against Fusarium solani in transgenic tobacco

Q. WANG, B.L. QIU, S. LI, Y.P. ZHANG, X.M. CUI, F. GE, D.Q. LIU

Biologia plantarum 63:797-807, 2019 | DOI: 10.32615/bp.2019.123

Plant defensins and defensin like protein (DEFL) form a large family of small cysteine-rich proteins. They are major components of plant immune systems, being involved in host defenses against biotic and abiotic stresses. In this study, a novel defensin like protein (DEFL) gene PnDEFL1 was isolated from Panax notoginseng, a traditional Chinese medicinal herb. The expression patterns of PnDEFL1 after treatment with methyl jasmonate, salicylic acid, ethephon, and H2O2, as well as during Fusarium solani infection, were analyzed using reverse transcription qPCR. The up-regulated expression of PnDEFL1 indicated that it responded to F. solani infection and all four defense-related signalling molecules. The PnDEFL1 gene was further fused with the green fluorescent protein gene in a plant expression vector and transformed into onion (Allium cepa) epidermal cells. The laser scanning confocal microscope confirmed that the PnDEFL1 protein localized to the extracellular region. In addition, the recombinant PnDEFL1 protein was expressed in Escherichia coli and purified by affinity chromatography. It had antifungal activities against F. solani, F. oxysporum, Botrosphaeria dothidea, and Sclerotinia sclerotiorum. The PnDEFL1 gene was transferred into tobacco (Nicotiana tabacum) to verify its function. The overexpression of PnDEFL1 in tobacco conferred a high resistance to F. solani infection. Thus, the PnDEFL1 gene is involved in the defense responses of P. notoginseng to F. solani infection.

Response of two Arabidopsis ecotypes Columbia-0 and Dijon-G to necrotrophic and biotrophic pathogens

Y.H. LEE, J.Y. MOON, H.J. KIM, J.M. PARK, I.S. HWANG, J.K. HONG

Biologia plantarum 63:654-661, 2019 | DOI: 10.32615/bp.2019.071

Arabidopsis thaliana L. ecotype Dijon-G (Di-G) showed a different symptom development during pathogenesis compared to ecotype Columbia-0 (Col-0). Previously, it has been shown that Di-G has a higher susceptibility to necrotrophic fungus Alternaria brassicicola than Col-0. In this study, Di-G showed enhanced disease susceptibility to necrotrophic fungi Botrytis cinerea, Sclerotinia sclerotiorum, and Sclerotium rolfsii known to secrete oxalic acid (OA) as a pathogenicity factor. Treatment with 50 and 100 mM OA resulted in a more leaf tissue collapse in Di-G than in Col-0. The OA also up-regulated expression of the salicylic acid (SA)-inducible pathogenesis-related gene 1 (PR1) and down-regulated expression of the jasmonic acid/ethylene-inducible defensin PDF1.2 gene in Di-G. By contrast, Di-G was resistant to hemibiotrophic fungus Colletotrichum higginsianum and biotrophic Turnip crinkle virus (TCV) infections. Application of 0.5 mM SA resulted in a higher accumulation of endogenous SA and in a preferential expression of SA-responsive genes in Di-G. Salicylic acid accelerated OA-triggered plant cell death and attenuated PDF1.2 expression in Di-G. These results suggest that the enhanced susceptibility of Di-G to necrotrophic pathogen infections might be mediated by attenuated JA-ethylene defence signalling and/or heightened SA-related defence signalling. Interaction of SA-signalling with OA secretion might be also involved in the enhanced susceptibility of Di-G.

Genome-wide analysis of heptahelical protein (HHP) gene family and expression of BcHHP1 in response to stresses in Brassica rapa

J. Wang, F.Y. Huang, X.L. Hou, X. You

Biologia plantarum 63:219-227, 2019 | DOI: 10.32615/bp.2019.025

Heptahelical protein (HHP) signalling pathway is involved in cold acclimation responses to low temperature and other stresses. The HHP transcription factor family is the key component regulating this signalling pathway. In this study, five HHP-like genes, BcHHP1, BcHHP2, BcHHP3, BcHHP4, and BcHHP5, were isolated from non-heading Chinese cabbage (Brassica rapa ssp. chinensis cv. Suzhouqing). Multiple sequence alignment and phylogenetic analysis showed that BcHHP proteins are highly homologous to HHP proteins from Arabidopsis thaliana, Glycine max, Oryza sativa, and Zea mays. Some of these HHP proteins might share similar functions in some aspects, which might be further proved by interaction network of BcHHP genes. Furthermore, real-time quantitative PCR showed that BcHHP1 was induced under cold and salt treatments. Besides, BcHHP1 was also accumulated in response to abscisic acid and salicylic acid, indicating that BcHHP1 gene might participate in response to hormone treatments. In addition, a BcHHP1-YFP fusion protein was localized to the nucleus and cytoplasm. These results indicated that five BcHHP genes might play important roles in a functional HHP signalling pathway responding to cold treatment. This work might be useful for future functional analysis of other HHP-like genes.

Transcriptome sequencing flower petals reveals insights into regulation of flavonoid biosynthesis in Osmanthus fragrans

Y.J. HAN*, M.F. DONG, H.Y. WANG, X.D. WANG, K. LI, F.D. SHANG*

Biologia plantarum 63:765-775, 2019 | DOI: 10.32615/bp.2019.146

Osmanthus fragrans Lour., one of the top 10 most popular flowers in China, is known for both its beauty and fragrance. It is rich in flavonoids, a class of secondary metabolites with significant neuroprotective, free-radical scavenging, and anti-oxidant activity. To understand the mechanisms regulating flavonoid biosynthesis, we conducted transcriptome sequencing O. fragrans flowers to analyze gene expressions during the full flowering stage. The RNA was isolated separately from petals of cvs. Yingui and Dangui, which were treated or not with jasmonic acid, salicylic acid, or abscisic acid. A total of 142 029 unigenes were denovo assembled, and 50 918 unigenes were annotated. The differentially expressed genes were identified, annotated, and classified. The results of transcriptome sequencing and real-time PCR revealed higher expressions of phenylalanine ammonia-lyase (PAL), PAL1, chalcone synthase (CHS), flavanone-3-hydroxylase (F3H), flavonol synthase (FLS), and lower expressions of dihydroflavonol-4-reductase (DFR), anthocyanidin synthase (ANS) in 'Yingui' than in 'Dangui'. Such an expression pattern facilitated the higher accumulation of flavonoids in 'Yingui'. Several genes of the flavonoid biosynthesis pathway were upregulated by jasmonic acid and salicylic acid in both the cultivars leading to flavonoid accumulation in their petals. In the v-myb avian myeloblastosis viral oncogene homolog 1(MYB1)-overexpressing petals, the expressions of PAL, PAL1, CHI, and FLS increased. The results suggest that MYB1 may participate in the flavonoid biosynthesis pathway and regulate the expression of some upstream genes in O. fragrans.

Genes involved in stress signals: the CBLs-CIPKs network in cold tolerant Solanum commersonii

S. ESPOSITO, V. D'AMELIA, D. CARPUTO*, R. AVERSANO*

Biologia plantarum 63:699-709, 2019 | DOI: 10.32615/bp.2019.072

Several studies revealed the important contribution of calcineurin B-like (CBLs) and CBL-interacting kinase (CIPKs) genes in transmitting stress signals in plants. Taking advantage from the genome sequences of the cultivated potato Solanum tuberosum and its wild relatives S. commersonii and S. chacoense, we identified for the first time 10 CBLs and 26 CIPKs genes in each species. The CBLs and CIPKs derived from tandem duplications indicate that these gene families in potato mainly arise through amplification mechanisms. Once annotated, we compared the par excellence model of Arabidopsis thaliana with S. commersonii, the potato model species for studying cold tolerance. We found that four ScCBL proteins (ScCBL1, ScCBL4a, ScCBL4b, and ScCBL9) started with a conserved N-myristoylation motif (MGXXXS/T), which might function in membrane targeting of the CBLs-CIPKs complex. Additionally, expression analyses of S. commersonii CBL and CIPK genes based on RNAseq revealed diverse expression patterns following various abiotic and biotic stresses and in the four tissues analyzed (flowers, leaf, roots, and tubers). Data also suggest that the ScCBLs-ScCIPKs complex may be more responsive to abiotic rather than biotic stimuli. Overall, the results described in the present work will be useful for future investigations and for functional characterization of individual CBLs and CIPKs in Solanum.

Identification of candidate reference genes in tropical bamboos stable across species, tissues, and developmental stages

S. Chakraborty, S. Dutta, P. Biswas, M. Das

Biologia plantarum 63:253-261, 2019 | DOI: 10.32615/bp.2019.029

Bamboo possesses many unique physiological characteristics, but the molecular understanding of many of these processes remains poorly understood till to date. One major reason is unavailability of sufficient sequence and expression data. Selection of suitable reference genes is pivotal to initiate any gene expression analyses. Although, suitable reference genes have been identified in the temperate bamboo Phyllostachys edulis, it has not been done for tropical bamboo. In this study, expression stability of 10 candidate reference genes were investigated in 4 widely grown tropical bamboo species (Bambusa tulda, B. balcooa, B. bambos, and B. vulgaris), different organs (young leaves from flowering and non flowering culms, flag leaf (leaf just below the mature inflorescence), possible flag leaf (leaf covering the immature inflorescence), culm sheath, internode, root, rhizome, and inflorescence bud), different parts (basal, middle, and tip regions of leaf; internodes located in the basal, middle, and tip region of the branch, and developmental stages early, middle, and late inflorescence buds) by using 3 reliable computational tools (geNorm, NormFinder, and RefFinder). A universal single reference gene for normalization of gene expression data was not identified. However, the eukaryotic initiation factor 4α (eIF4α), clathirin adaptor complexes medium subunit (CAC), and nucleotide tract-binding protein (NTB) were found stable in the selected organs across different bamboo species. On the other hand, eIF4α ranked top when different organs and peptidyl prolyl cis-trans isomerase/cyclophilin (CYP), eukaryotic elongation factor 1α (eEF1α) and ubiquitin 5 (UBQ5) ranked top when different developmental stages of B. tulda were analyzed. Taken together, this study not only identifies reference gene/s that are stable across species, organs, and developmental stages of bamboo, but it also assesses the impacts of major contributing factors regulating expression stability of the reference genes.

Effects of nitric oxide and Fe supply on recovery of Fe deficiency induced chlorosis in peanut plants

Y. L. Song, Y. J. Dong, X. Y. Tian, W. W. Wang, Z. L. He

Biologia plantarum 61:155-168, 2017 | DOI: 10.1007/s10535-016-0642-2

The effects of nitric oxide (NO) and/or iron (Fe) supplied to Fe deficient plants have been investigated in peanut (Arachis hypogaea L.) grown in Hoagland nutrient solution with or without Fe. Two weeks after Fe deprivation, recovery was induced by addition of 250 μM sodium nitroprusside (SNP, a NO donor) and/or 50 μM Fe (Fe-EDTA) to the Fe deprived (-Fe) nutrient solution. Activities of antioxidant enzymes, leaf chlorophyll (Chl), and active Fe content decreased, whereas activities of H+-ATPase, ferric-chelate reductase (FCR), nitrate reductase, and nitric oxide synthase and NO production increased in Fe deficient plants, consequently an Fe chlorosis symptom appeared obviously. In contrast, these symptoms disappeared gradually after two weeks with NO and/or Fe supply, which caused an increases in leaf Chl and active Fe content, especially following by co-treatment with NO and Fe to values found in Fe sufficient plants. Increased activities of antioxidant enzymes (superoxide dismutase, peroxidase, and catalase) and decreased accumulation of reactive oxygen species (H2O2, O2*- ) and malondialdehyde enhanced the ability of resistance to oxidative stress. Supplied NO alone had the obvious effect on increased NO production and on activity of H+-ATPase and FCR, whereas root length and root/shoot ratio were most effectively increased by Fe supplied alone. Co-treatment with NO and Fe did the best effects on recovery peanut chlorosis symptoms by significantly increased Chl and available Fe content and adjusted distribution of Fe and other mineral elements (Ca, Mg, and Zn) in both leaves and roots.

Transcriptome-wide identification and expression analyses of ABC transporters in dwarf polish wheat under metal stresses

X. Wang, C. Wang, H. Sheng, Y. Wang, J. Zeng, H. Kang, X. Fan, L. Sha, H. Zhang, Y. Zhou

Biologia plantarum 61:293-304, 2017 | DOI: 10.1007/s10535-016-0697-0

ABC transporters, which comprise one of the largest protein families, are involved in maintaining osmotic homeostasis, nutrient uptake, pathogen resistance, and metal tolerance. In this study, 30 ABC genes in dwarf polish wheat were characterized and classified into seven subfamilies (ABCA - ABCG). Among them, 24 ABC transporters were newly found in wheat. The expressions of 13 ABC genes in roots and leaves under six metal stresses were also analyzed. All these genes were differentially regulated by Cd (except ABCE2, ABCF4, and ABCF6 in roots), suggesting that these genes participate in Cd transport, sequestration, or uptake. These genes were also differentially regulated by other metals including Cu, Mg, Zn, Fe, and Ni. Results suggest that the expressions of ABC transporters in dwarf polish wheat played important roles in metal transport and detoxification.

Enhancement of polysaccharides accumulation in Dendrobium officinale by exogenously applied methyl jasmonate

Z. Q. Yuan, J. Y. Zhang, T. Liu

Biologia plantarum 61:438-444, 2017 | DOI: 10.1007/s10535-016-0702-7

The accumulation of polysaccharides, activities of sucrose metabolism enzymes, and the expression of sucrose biosynthetic genes in Dendrobium officinale were significantly affected by exogenous methyl jasmonate (MeJA). Application of MeJA increased the content of polysaccharides and the highest polysaccharide production occurred in the samples treated with 200 μM MeJa. The MeJA application influenced polysaccharide biosynthesis rather than degradation because the activities of sucrose metabolism enzymes and the expressions of sucrose biosynthetic genes were upregulated by MeJA. Interestingly, low MeJA concentrations promoted accumulation of Dendrobium polysaccharides, while high MeJA amounts played an inhibitory role. The content of major constituent of polysaccharides, glucose and mannose, also increased after MeJa treatment.

Root characteristics of grafted peppers and their resistance to Fusarium solani

X. Duan, H. G. Bi, T. Li, G. X. Wu, Q. M. Li, X. Z. Ai

Biologia plantarum 61:579-586, 2017 | DOI: 10.1007/s10535-016-0677-4

Root rot caused by Fusarium solani, is one of the most severe diseases in pepper (Capsicum annuum L.). Grafting has been attempted as an effective means to control the disease, but little is known about the disease resistance mechanism in grafted pepper. Therefore, we investigated the changes of biomass, cell structure, and the secondary metabolism in roots of control (non-grafted pepper) and grafted peppers using cvs. Weishi and Buyeding as rootstocks and the cv. Xinfeng 2 as a scion. After a manual inoculation, less F. solani invaded grafted pepper roots and consequently less serious injury to the root cell ultra-structure compared with the control was found. The roots of grafted pepper infected with F. solani exhibited greater biomass production and root activity than the roots of infected controls. Grafting led to an increased content of salicylic acid, benzoic acid, vanillin, lignin, and polyamines, as well as activities of phenylalanine ammonia lyase, polyphenoloxidase, and peroxidase. These results suggest that grafting improved the resistance of peppers to root rot.

The cytotoxic targets of anatase or rutile + anatase nanoparticles depend on the plant species

S. Silva, H. Oliveira, A. M. S. Silva, C. Santos

Biologia plantarum 61:717-725, 2017 | DOI: 10.1007/s10535-017-0733-8

The potential toxicity of nanoparticles (NPs) is under debate. Information about TiO2 NPs phytotoxicity is still limited partly due to the different TiO2 NP forms that may be found in the environment. The present work investigated the impact of different TiO2 NPs forms (rutile and anatase) on germination, growth, cell cycle profile, ploidy level, and micronucleus formation in Lactuca sativa (lettuce) and Ocimum basilicum (basil). Seeds were exposed to anatase (ana) or rutile + anatase (rut+ana) at concentrations 5 - 150 mg dm-3 for 5 d and after that different parameters were analyzed. Rut+ana showed high potential to impair germination and growth. On the other hand, ana alone showed a positive influence on seedling growth. Despite that, ana induced severe alterations in cell cycle dynamics. Regarding species, basil was more sensitive to TiO2 NPs cytostatic effects (delay/arrest in G0/G1 phase), whereas in lettuce, TiO2 NPs were more genotoxic (micronucleus formation increase). Finally, we propose that, besides germination and plant growth, cell cycle dynamics and micronucleus formation can be sensitive biomarkers of these NPs.

Overexpression of UDP-glucose dehydrogenase from Larix gmelinii enhances growth and cold tolerance in transgenic Arabidopsis thaliana

N. N. Li, L. Chen, X. H. Li, Q. Li, W. B. Zhang, K. Takechi, H. Takano, X. F. Lin

Biologia plantarum 61:95-105, 2017 | DOI: 10.1007/s10535-016-0657-8

Uridine diphosphate glucose dehydrogenase (UGDH) plays an important role in biosynthesis of hemicellulose by catalyzing oxidation of UDP-glucose (UDP-Glc) to UDP-glucuronate (UDP-GlcA), a key sugar nucleotide involved in biosynthesis of the plant cell wall. In this study, a UGDH ortholog referred to as LgUGDH was isolated from Larix gmelinii using PCR and rapid amplification of cDNA ends techniques. Real-time PCR shows that the LgUGDH gene was expressed primarily in larch stems in addition to its roots and leaves, and Southern blot analysis indicates that UGDH is encoded by two paralogous genes in L. gmelinii. Overexpression of LgUGDH increased the content of soluble sugars and hemicelluloses and enhanced vegetative growth and cold tolerance in transgenic Arabidopsis thaliana. These results reveal that L. gmelinii UGDH participates in sucrose/polysaccharide metabolism and cell wall biosynthesis and may be a good candidate gene for enhancing plant growth, cold tolerance, and hemicellulose content.

Gene expression and flavonol biosynthesis are induced by ultraviolet-B and salt stresses in Reaumuria trigyna

H. Zhang, Z. Wu, Y. Suo, J. Wang, L. Zheng, Y. Wang

Biologia plantarum 61:246-254, 2017 | DOI: 10.1007/s10535-017-0725-8

In plants, flavonoids play roles not only in development, but also in responses to biotic and abiotic stresses. We analyzed the transcriptome data of NaCl-treated Reaumuria trigyna, a small, highly haloduric desert shrub, focusing on the flavonoid biosynthetic pathway. We identified 118 unigenes annotated as genes encoding enzymes related to flavonoid biosynthesis, 68 of which were differentially expressed under NaCl treatment (39 upregulated, 29 downregulated). Of the 118 annotated unigenes, 47 were annotated as members of families related to the flavonol biosynthetic pathway (e.g., F3H, FLS, and OMT). Of those 47 genes, about 70 % (32 unigenes) were upregulated under NaCl treatment. Experiments were conducted to monitor changes in gene expression and accumulation of total polyphenols, total flavonols, and antioxidant capacity under NaCl and ultraviolet-B (UV-B) radiation treatments. The expressions of genes related to the flavonol biosynthesis pathway (RtC4H, RtCHS, RtF3H3, RtFLS1, RtFLS2, RtF3'5'H, RtF3'H, RtOMT, and RtMYBF1) increased under NaCl and UV-B treatments. Treatments with NaCl and UV-B also increased the total flavonols content and antioxidant activity. The content of several flavonols including rutin, hyperoside, isorhamnetin-3-O-neohespeidoside, and myricetin increased in response to NaCl and UV-B stresses. Overall, our results show that the expression of genes related to flavonol biosynthesis as well as flavonol content increased in R. trigyna under NaCl and UV-B stresses.

Transcriptional properties of eight synthetic pathogen-inducible promoters in transgenic Arabidopsis thaliana

Z. C. Huang, S. Peng, H. Li, F. H. Zeng

Biologia plantarum 61:389-393, 2017 | DOI: 10.1007/s10535-016-0665-8

Synthetic pathogen-inducible promoters (SPIP) hold a great promise to meet the demands for a desired temporal and spatial regulation of transgenes. Four pathogen-inducible cis-elements (F-box, S-box, Gst1-box, and W-box) and the minimal cauliflower mosaic virus 35S (CaMV 35S) promoter (-46 to +8 TATA box) were used to design SPIP. Eight SPIP were synthesized and named FSGW, FSWG, GWFS, GWSF, SFGW, SFWG, WGFS, and WGSF according to the order of cis-element dimers. They were used to replace the CaMV 35S promoter in the plasmid pBI121 to control expression of the β-glucuronidase (gus) gene. The transcriptional properties of each SPIP were evaluated in homozygous T3 lines of transgenic Arabidopsis thaliana by histochemical staining gus expression and real time quantitative PCR. FSGW and FSWG had a very low basal level and a poor inducibility. The other six SPIP showed different levels of background and inducibility. Using Ralstonia solanacearum, the spores of Phytophthora capsici, and salicylic acid as inducing factors, GWSF showed the advantages of a low basal expression, rapid response, and efficient transcriptional activity in the rosette leaves of five-week-old plants. The results indicate that the permutation and combination of the cis-elements had important effects on transcriptional activities of SPIP. Synthetic pathogen-inducible promoters like GWSF are valuable because it can potentially be further improved to apply to plant genetic engineering for disease resistance.

Functional characterization of the antioxidant enzymes in rice plants exposed to salinity stress

I. L. Vighi, L. C. Benitez, M. N. Amaral, G. P. Moraes, P. A. Auler, G. S. Rodrigues, S. Deuner, L. C. Maia, E. J. B. Braga

Biologia plantarum 61:540-550, 2017 | DOI: 10.1007/s10535-017-0727-6

The objective of this study was to relate the activation of enzymatic antioxidant system to the production of reactive oxygen species induced by salt stress. Rice (Oryza sativa L.) genotypes BRS Bojuru and BRS Pampa, tolerant and sensitive to salinity, respectively, were subjected to 150 mM NaCl for 0, 6, 24, 48, and 72 h. A significant increase of superoxide anion and H2O2 and a decrease in malondialdehyde (MDA) content were observed in the tolerant genotype, whereas in the sensitive genotype, there was no change in superoxide anion content, reduced H2O2 content, and increased MDA content. The superoxide dismutase (SOD) activity increased significantly in both genotypes, and increases in amounts of transcript were observed for OsSOD3Cu/Zn and OsSODA1-Mn in the tolerant genotype and for OsSOD4-Cu/Zn, OsSOD3-Cu/Zn, OsSODCc1-Cu/Zn, OsSOD-Fe, and OsSODA1-Mn in the sensitive genotype. The activities of catalase (CAT), ascorbate peroxidase (APX), and glutathione reductase (GR) were not significantly and consistently changed, but OsCATA, OsAPX2 and OsGR1 were induced in both genotypes. OsCATB transcription was increased in the tolerant genotype and OsCATC and OsAPX3 in the sensitive genotype under salinity. It is concluded that OsAPX3, OsGR2, OsGR3, and OsSOD3-Cu/Zn genes are the most suitable to distinguish tolerant from sensitive genotypes under salt stress.

Sulphur deficiency inhibits nitrogen assimilation and recycling in barley plants

C. G. Veliz, I. N. Roberts, M. V. Criado, C. Caputo

Biologia plantarum 61:675-684, 2017 | DOI: 10.1007/s10535-017-0722-y

Sulphur (S) is incorporated into diverse primary and secondary metabolites that play important roles in proper growth and development of plants. In cereals, a fraction of the nitrogen (N) accumulated in developing grains is guaranteed by amino acid remobilization from vegetative tissues, a contribution that becomes critical when soil nutrients are deficient. Glutamine synthetase (GS) and amino acid transporters (AAT) are key components involved in N assimilation and recycling. The aim of the present study was to evaluate the effect of S availability on the expressions of HvGS and several selected HvAAT genes in barley plants and on the phloem exudation rate of amino acids. To this end, two independent experiments were designed to impose low S availability conditions to barley plants. Low S availability caused a decrease in the phloem exudation rate of amino acids as well as in the gene expression of all the HvGS genes and five of the six HvAAT genes analyzed. The strong correlation found between the phloem amino acid exudation rate and HvGS1-1, HvGS1-2, HvAAP7, and HvProT1 gene expression may indicate the participation of these genes in the regulation of amino acid remobilization through the phloem.

Single nucleotide polymorphism markers linked to root elongation rate in sugar beet

P. Stevanato, D. Trebbi, M. Saccomani

Biologia plantarum 61:48-54, 2017 | DOI: 10.1007/s10535-016-0643-1

The aim of this study was to identify single nucleotide polymorphism (SNP) markers genetically linked to root elongation rate (RER) in sugar beet (Beta vulgaris L.). A population of 244 F3 individuals, obtained from the cross between lines L01 (a low RER) and L18 (a high RER), was phenotyped by measuring RER of 11-d-old seedlings grown in a hydroponic culture. Two DNA bulks of 50 F3 individuals with extreme phenotypes were used for bulk segregant analysis by restriction-associated DNA sequencing. A total of 20 376 SNPs were identified. Single nucleotide polymorphisms were filtered to reduce the number of the false positive and mapped on candidate chromosomal regions of the B. vulgaris reference genome. One of the total of SNPs selected, SNP10139, was strongly linked to RER (P < 0.01). The pattern of association between the SNP10139 genotype and RER was also evaluated on a breeding line panel comprising 40 low and 40 high RER individuals with different allele frequencies between groups (P < 0.01). The SNP10139 sequence was mapped on the B. vulgaris peptide transporter (PTR) gene, a carrier that influences root elongation in Arabidopsis thaliana. Our results suggest that SNP10139 influence RER in sugar beet, and sequence information can be used in marker-assisted selection programs.

Molecular responses to drought stress in plants

G. Kaur, B. Asthir

Biologia plantarum 61:201-209, 2017 | DOI: 10.1007/s10535-016-0700-9

Drought is a severe environmental constraint to plant productivity. Being a multidimensional stress, it triggers a wide variety of plant responses ranging from physiological, biochemical to molecular levels. One of the inevitable consequences of drought stress is an increase in reactive oxygen species (ROS) production in different cellular compartments, namely the chloroplasts and mitochondria. This enhanced ROS production is, however, kept under tight control by a versatile and cooperative antioxidant system that modulates intracellular ROS content and sets the redoxstatus of the cell. Furthermore, ROS production under stresses functions as an alarm signal that triggers defence or acclimation. Specific signal transduction pathways involve, e.g., H2O2 as a secondary messenger. ROS signalling under drought is linked to abscisic acid (ABA) and Ca2+ fluxes. At molecular levels, several drought-responsive genes, transcription factors, aquaporins, late embryogenesis abundant proteins, heat shock proteins, and dehydrins have been identified. This review discusses recent understanding on molecular responses and protective mechanisms of drought stress.

Altered gibberellin content affects growth and development in transgenic tobacco lines overexpressing a wheat gene encoding F-box protein

S. Yin, S. Zhou, X. Kong, Y. Han, W. Wang

Biologia plantarum 61:349-358, 2017 | DOI: 10.1007/s10535-017-0707-x

In a previous study, we have identified and characterized gene from wheat (Triticum aestivum L.) encoding F-box protein and named it TaFBA. In this paper, transgenic tobacco (Nicotiana tabacum L.) plants overexpressing TaFBA1 displayed accelerated growth early, but the rate slowed gradually at later stages of growth, and the mature transgenic plants were even shorter in stature and flowered later than did the wild type (WT). Treatment with gibberellin (GA) conferred an accelerated growth rate to the transgenic tobacco plants at later stages, similar to that of WT, whereas growth was inhibited more seriously in WT than in transgenic tobacco when plants were treated with a GA biosynthesis inhibitor. The content of GA in transgenic tobacco plants was higher at early developmental stages, but it was lower at later growth stages than in WT. Some GA biosynthesis genes were down regulated, which was accompanied with elevated expression of a GA catabolism gene. Thus, our results suggest that TaFBA1 is possibly involved in the regulation of plant growth and development, and that it may be related to the production, metabolism, and proper function of GA.

Constitutive expression of SlTrxF increases starch content in transgenic Arabidopsis

F. B. Wang, W. L. Kong, Y. R. Fu, X. C. Sun, X. H. Chen, Q. Zhou

Biologia plantarum 61:494-500, 2017 | DOI: 10.1007/s10535-016-0675-6

The plastidic thioredoxin F-type (TrxF) protein plays an important role in plant saccharide metabolism. In this study, a gene encoding the TrxF protein, named SlTrxF, was isolated from tomato. The coding region of SlTrxF was cloned into a binary vector under the control of 35S promoter and then transformed into Arabidopsis thaliana. The transgenic Arabidopsis plants exhibited increased starch accumulation compared to the wild-type (WT). Real-time quantitative PCR analysis showed that constitutive expression of SlTrxF up-regulated the expression of ADP-glucose pyrophosphorylase (AGPase) small subunit (AtAGPase-S1 and AtAGPase-S2), AGPase large subunit (AtAGPase-L1 and AtAGPase-L2) and soluble starch synthase (AtSSS I, AtSSS II, AtSSS III and AtSSS IV) genes involved in starch biosynthesis in the transgenic Arabidopsis plants. Meanwhile, enzymatic analyses showed that the major enzymes (AGPase and SSS) involved in the starch biosynthesis exhibited higher activities in the transgenic plants compared to WT. These results suggest that SlTrxF may improve starch content of Arabidopsis by regulating the expression of the related genes and increasing the activities of the major enzymes involved in starch biosynthesis.

The identification of almond GIGANTEA gene and its expression under cold stress, variable photoperiod, and seasonal dormancy

P. M. Barros, S. Cherian, M. Costa, H. Sapeta, N. J. M. Saibo, M. M. Oliveira

Biologia plantarum 61:631-640, 2017 | DOI: 10.1007/s10535-017-0711-1

Seasonal growth is characteristic for many tree species including almond. Varying conditions during the season are responsible for growth cessation, bud set, dormancy entry, cold hardening, and bud burst. Here, we report the characterization of an almond homologue of the Arabidopsis GIGANTEA (AtGI) gene (designated as PdGI, GenBank accession No. KJ502316). We propose a role for this gene in the transition to dormancy and cold acclimation. The complementary DNA (cDNA) sequence of PdGI was 4 322 bp long and contained an open reading frame of 3 512 bp. The deduced amino acid sequence of PdGI shared 76 % identity with AtGI. The expression of PdGI at ambient day/night temperatures of 22/20 ºC was differentially regulated under a 16-h or 12-h photoperiod, increasing during the day and decreasing after dusk. However, this diurnal regulation was disrupted when plants were transferred to cold (12 ºC) conditions. In addition, we have assessed the expression of PdGI and putative almond homologues of the downstream target genes CONSTANS (PdCO-like) and FLOWERING LOCUS T (PdFT-like) in flower buds and shoots from adult trees during the bud break period in autumn and early winter. Our results show a clear increase in transcript abundance towards anthesis, suggesting a role of these genes in flower development.

 previous    ...   3   4   5   6   7  8   9   10   11   12   ...    next