biologia plantarum

International journal on Plant Life established by Bohumil Nìmec in 1959

Fulltext search in archive



« advanced mode »

 previous    1   2   3   4   5   6  7   8   9   10   11   ...    next 

Results 151 to 180 of 6171:

The tomato cytosolic fructokinase FRK1 is important for phloem fiber development

O. Stein, F. Secchi, M. A. German, H. Damari-Weissler, R. Aloni, N. M. Holbrook, M. A. Zwieniecky, D. Granot

Biologia plantarum 62:353-361, 2018 | DOI: 10.1007/s10535-017-0762-3

Tomato (Solanum lycopersicum) plants have four fructokinase genes, SlFRK1-4. The SlFRK4 is expressed only in pollen whereas the other three are expressed in all plant parts. While SlFRK2 and SlFRK3 are involved in vascular tissue development and affects the shape, size, and cell-wall width of xylem vessels and xylem fibers, the role of SlFRK1 has not been studied previously. The current work investigates the expression of SlFRK1 using transgenic tomato plants expressing the β-glucuronidase reporter gene under the SlFRK1 promoter, as well as the role of SlFRK1 using transgenic plants with antisense suppression of SlFRK1. The SlFRK1 promoter is expressed primarily in vascular tissues and specific suppression of SlFRK1 reduces water transport in stems, but has no other anatomical or phenotypic effects. Combined suppression of SlFRK1 and SlFRK2 severely inhibited plant growth and an anatomical analysis revealed a reduction in secondary xylem area and distorted phloem fibers characterized by thin cell walls and reduced lignification. The results suggest that SlFRK1 is involved in vascular tissue development and hydraulic conductivity in tomato plants and that SlFRK1 is important for normal phloem fiber development, together with SlFRK2.

Overexpression of glycine-rich RNA-binding protein in tomato renders fruits with higher protein content after cold storage

G. M. Ruggieri, A. Triassi, C. E. Alvarez, A. Gola, J. Wiggenhauser, C. O. Budde, M. V. Lara, M. F. Drincovich, G. L. Müller

Biologia plantarum 62:501-510, 2018 | DOI: 10.1007/s10535-018-0794-3

Glycine-rich RNA-binding proteins (GR-RBPs) are involved in RNA processing and also some of them are output signals of the circadian clock. In tomato, one GR-RBP gene family (LeGRP1) is composed by three highly homologous genes (LeGRP1a-c); each one rendering three transcriptional products: the un-spliced pre-RNA (preLegrp1a-c), the mature mRNA (mLegrp1a-c) and the alternatively spliced mRNA (asLegrp1a-c). To get insight into their regulation and impact on RNA metabolism in fruits, Solanum lycopersicum cv. Micro-Tom was transformed with preLeGRP1a fused to the polygalacturonase promoter, which drives expression to fruits from the mature green stage. Our results demonstrated a complex positive regulation of LeGRPs, in which LeGRP1a overexpression led to the induction of the others LeGRP1 members. Even though the LeGRP1 transcription and the content of three LeGRPs proteins were affected, the overall LeGRP protein circadian rhythm profile was similar in transgenic and wild type (WT) fruits. However, when the fruits were kept at a chilling temperature after harvest, total protein content was significantly higher in transgenic than in WT fruits, and the content of some free amino acids was modified. The results obtained suggest a probable role of LeGRP1s: structural rearrangements and/or stabilization of mRNA to allow efficient processing of fruits under cold conditions.

Enhanced multiplication and improved ex vitro acclimatization of Decalepis arayalpathra

Z. Ahmad, A. Shahzad, S. Sharma

Biologia plantarum 62:1-10, 2018 | DOI: 10.1007/s10535-017-0746-3

The proposed work describes a protocol for high-frequency in vitro regeneration through nodal segments and shoot tips in Decalepsis arayalpathra, a critically endangered medicinal liana of the Western Ghats. Nodal segments were more responsive than shoot tips in terms of shoot proliferation. Murashige and Skoog's (MS) basal medium supplemented with 5.0 μM 6-benzyladenine (BA) was optimum for shoot initiation through both the explants. Among different combinations of plant growth regulators and growth additive screened, MS medium added with 5.0 μM BA + 0.5 μM indole-3-acetic acid + 20.0 μM adenine sulphate effectuated the highest response: 11.8 shoots per nodal segment and 5.5 shoots per shoot tip with mean shoot length of 9.2 and 4.8 cm, respectively. Half-strength MS medium with 2.5 μM α-naphthalene acetic acid was optimum for in vitro root induction. The plantlets with the well developed shoot and root were acclimatized in Soilrite™ with 92 % survival rate in the field conditions. During acclimatization, chlorophyll content, net photosynthetic rate, stomatal conductance, and transpiration rate were gradually changed in dependence of formation of new leaves. Further, the changes in activities of antioxidant enzymes, i.e., superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), and glutathione reductase (GR) as well as activity of carbonic anhydrase were also observed: a continuous rise in SOD activity, but a rise and fall in the activities of CAT, APX, and GR were also noticed. Maximum fresh mass (3.1 g plant-1), dry mass (0.35 g plant-1) of roots and 2-hydroxy-4-methoxybenzaldehyde content of 9.22 μg cm-3(root extract) were recorded after 8 weeks of acclimatization.

The effects of silver ions and silver nanoparticles on cell division and expression of cdc2 gene in Allium cepa root tips

A. S. Fouad, R. M. Hafez

Biologia plantarum 62:166-172, 2018 | DOI: 10.1007/s10535-017-0751-6

The effects of silver nanoparticles (AgNPs), silver ions (Ag+), and polyvinylpyrrolidone (PVP) on mitosis and expression of a gene encoding cyclin-dependent kinase 2 (cdc2) in onion roots were compared. Three concentrations (5, 10, and 15 mg dm-3) were employed in combination with three incubation times (3, 6, and 9 h). PVP enhanced mitotic index and cdc2 expression. Both silver forms decreased mitotic index and cdc2 expression. Genotoxicity of both silver forms were indicated by three major distinguishable classes of chromosome aberrations: spindle disturbances, clastogenic aberrations, and chromosome stickiness. Concerning Ag+ treatments, significant enhancements in occurrence of any chromosome aberration type was associated with significant decrease in mitotic index. On the other hand, disturbed spindle in AgNPs treatments was observed even in absence of significant reduction in mitotic index suggesting that AgNPs inhibit cellular events occurring during mitosis to proceed normally rather than starting of cell division.

Osmotic stress affects growth, content of chlorophyll, abscisic acid, Na+, and K+, and expression of novel NAC genes in contrasting rice cultivars

S. García-Morales, F. C. Gómez-Merino, L. I. Trejo-Téllez, L. Tavitas-Fuentes, L. Hernández-Aragón

Biologia plantarum 62:307-317, 2018 | DOI: 10.1007/s10535-017-0761-4

Osmotic stress causes a series of morphological, physiological, biochemical, and molecular changes that alters plant growth, development, and productivity around the globe. Phytohormones, nutrients, and transcription factors may induce adaptive responses to osmotic stress in plants. We evaluated the effect of osmotic stress induced by 18.5 % polyethylene glycol (PEG) or 100 mM NaCl on growth, content of abscisic acid (ABA), chlorophyll (Chl), sodium, and potassium, and the expression of multifunctional NAC transcription factors in rice cultivars (the salt-tolerant Cotaxtla and salt-sensitive Tres Ríos). The PEG and NaCl decreased shoot height and increased ABA content in both cultivars, and reduced root length in cv. Tres Ríos. The PEG increased Chl content in cv. Cotaxtla leaves. NaCl reduced shoot K+ content in cv. Tres Ríos and increased shoot and root Na+ content in both cultivars, thus resulting in a decreased K+/Na+ ratio. Of the 57 NAC genes evaluated, two of them were repressed (Os10g42130 and Os07g04560) and two other induced (Os02g34970 and OsNAC10) in cv. Cotaxtla in response to PEG, whereas three of them were repressed (Os10g42130, Os07g04560 and Os08g10080), and six induced (Os02g56600, Os02g34970, Os11g08210, Os05g34830, OsNAC6, and OsNAC10) in response to NaCl. In the cv. Tres Ríos, we found two genes repressed (Os10g42130 and Os07g04560), and five induced (Os08g33910, Os03g60080, Os06g51070, OsNAC6, and OsNAC10) in response to PEG, while only two genes were repressed (Os10g42130 and Os07g04560) but 13 induced (Os03g21060, Os08g39110, Os03g60080, Os01g15640, Os06g51070, Os09g33490, Os04g40130, Os12g29330, Os02g36880, Os11g08210, Os05g34830, OsNAC6, and OsNAC10) by NaCl. Osmotic stress affected more severely cv. Tres Ríos than cv. Cotaxtla plants. These different responses might be regulated by ABA and NAC transcription factors.

Physiological and molecular mechanisms of brassinosteroid-induced tolerance to high and low temperature in plants

I. Sadura, A. Janeczko

Biologia plantarum 62:601-616, 2018 | DOI: 10.1007/s10535-018-0805-4

Brassinosteroids (BRs) are plant hormones that were isolated for the first time in the 1970s. This group currently includes more than 70 compounds that differ in their structure and physiological activity. BRs are present in plants in a free form or in the form of conjugates. BRs are known as plant growth regulators, but they also play a role in the plant response to environmental stresses. In the case of plants that are exposed to low/high temperature, exogenous BRs can counteract growth inhibition and reduce biomass losses as well as increase plant survival. BRs show a multidirectional activity in regulating the metabolism of plants exposed to extreme temperatures. The following BRs actions can be distinguished: changes in membrane physicochemical properties, regulation of the expression of selected genes (including stress-responsive genes), as well as indirect effects on metabolism through other hormones or signalling molecules (such as hydrogen peroxide). This review summarizes the current knowledge about the effects of BRs on the physiological and biochemical processes that occur in plants during exposure to low or high temperatures.

Molecular cloning and characterization of a PR-5 like protein gene from Brassica campestris ssp. chinensis

C. Liu, H. L. Liu, Y. Wang, D. Hu, D. Xiao, C. W. Zhang, X. L. Hou, Y. Li

Biologia plantarum 62:786-792, 2018 | DOI: 10.1007/s10535-018-0820-5

Downy mildew caused by Hyaloperonospora parasitica is a serious fungal disease in non-heading Chinese cabbage (Brassica campestris L. ssp. chinensis Makino). Pathogenesis-related 5 (PR-5) genes play an important role in plant resistance to disease invasion. In this study, a gene encoding pathogenesis-related 5-like (PR-5L) protein, named BcPR-5L, was successfully cloned from non-heading Chinese cabbage. The cDNA sequence of BcPR-5L is 747 bp in length. It encoded a protein of molecular mass of 25.78 kDa, an isoelectric point of 4.42, and containing 248 amino acids. Multiple sequence alignment indicated that BcPR-5L protein was highly homologous to other PR-5L proteins identified in 13 different species, with the highest homology to Brassica rapa. We analyzed the subcellular localization of BcPR- 5L protein by using onion epidermal cells and found that it is localized in the membrane. Real time quantitative PCR analyses revealed that the expression of BcPR-5L gene was significantly upregulated after H. parasitica infection, and the expression in the resistant cultivar was higher than that in the susceptible cultivar. In summary, our data suggest that BcPR-5L gene may play an important role in the resistance of non-heading Chinese cabbage to H. parasitica infection.

The effect of boron availability, CO2, and irradiance on relative accumulation of the major boron transport proteins, BOR1 and NIP5;1

S. Mishra, S. A. Heckathorn, J. M. Frantz, C. Krause

Biologia plantarum 62:121-128, 2018 | DOI: 10.1007/s10535-017-0744-5

Boron (B) is an essential plant micronutrient. Two major B-transport proteins have been recently identified and partially characterized: BOR1, a high-affinity B efflux transporter involved in xylem loading, and NIP5;1, a plasma-membrane boric-acid channel involved in B uptake. To date, studies of these B transporters have investigated their expression individually (mainly as mRNA), and only in response to variation in B availability (mostly B deficiency); the influence of other factors, such as plant resource status, has not been studied. To address this, we grew geranium (Pelargonium × hortorum cv. Maverick White) plants under ambient or elevated CO2 concentration, different sub-saturating irradiances, and different B availability. For comparison we also grew three other species (Arabidopsis thaliana, Azolla caroliniana, and Hordeum vulgare) under broad range of B supply. Relative accumulation of BOR1 and NIP5;1 proteins were measured using protein-specific antibodies and Western blotting or ELISA. Elevated CO2 significantly increased content of NIP5;1, while increases in irradiance increased BOR1 content, but decreased NIP5;1 content. Across species, content of both transporters often decreased with increasing B availability, but sometimes remained unchanged or even increased, depending on CO2, irradiance, species, or transporter. Content of BOR1 and NIP5;1 was correlated with root proteins, B content, and sugar content (for high CO2 only), as well as B uptake, but CO2 and irradiance often affected these relationships. Thus, relative accumulation of BOR1 and NIP5;1 is influenced not only by B content, as expected, but by other environmental factors as well.

NaPi/SX-RNase segregates as a functional S-RNase and is induced under phosphate deficiency in Nicotiana alata

H. J. Rojas, C. Caspani, E. G. Escobar, R. Quiroga, A. Goldraij

Biologia plantarum 62:261-268, 2018 | DOI: 10.1007/s10535-018-0783-6

In plants, class III T2 RNases involves two groups of structurally similar proteins, but with different biological functions: S-RNases and non-S-RNases. S-RNases have been involved in self-incompatibility whereas non-S-RNases have been implicated in stress responses. Here we report a novel class III RNase termed NaPi/Sx-RNase, which works both in self-incompatibility and in response to phosphate deficiency. The NaPi/Sx-RNase gene was identified in roots of Nicotiana alata grown in the absence of inorganic phosphate. Phylogenetic analysis showed that NaPi/Sx-RNase was included within the class III RNase T2 group. The NaPi/Sx-RNase was expressed in styles and its temporal expression increased in parallel to stylar development, with a slight decrease after anthesis. Progeny analysis showed that NaPi/Sx-RNase and S107-RNase, a functional allele of the self-incompatibility system, segregated in a 1:1 ratio. The progeny segregation of a semicompatible cross, in which NaPi/Sx-RNase was shared by the two parents, exhibited a pattern consistent with a functional S-RNase allele. Considering genetic segregation, primary structure, and physiological role, the NaPi/Sx-RNase may be either an S-RNase with diversified functions or a non-S-RNase linked to the S-locus. To our knowledge, this is the first evidence for a specific function of the S-locus other than the self-incompatibility reaction. These results support the hypothesis that the self-incompatibility and stress responses may have evolved from a common origin.

Leaf senescence in response to elevated atmospheric CO2 concentration and low nitrogen supply

E. Agüera, P. De la Haba

Biologia plantarum 62:401-408, 2018 | DOI: 10.1007/s10535-018-0798-z

This review reports the physiological and metabolic changes in plants during development under elevated atmospheric carbon dioxide concentration and/or limited-nitrogen supply in order to establish their effects on leaf senescence induction. Elevated CO2 concentration and nitrogen supply modify gene expression, protein content and composition, various aspects of photosynthesis, sugar metabolism, nitrogen metabolism, and redox state in plants. Elevated CO2 usually causes sugar accumulation and decreased nitrogen content in plant leaves, leading to imbalanced C/N ratio in mature leaves, which is one of the main factors behind premature senescence in leaves. Elevated CO2 and low nitrogen decrease activities of some antioxidant enzymes and thus increase H2O2 production. These changes lead to oxidative stress that results in the degradation of photosynthetic pigments and eventually induce senescence. However, this accelerated leaf senescence under conditions of elevated CO2 and limited nitrogen can mobilize nutrients to growing organs and thus ensure their functionality.

Aerenchyma development in different root zones of maize genotypes under water limitation and different phosphorus nutrition

A. S. Díaz, G. M. Aguiar, M. P. Pereira, E. Mauro de Castro, P. C. Magalhães, F. J. Pereira

Biologia plantarum 62:561-568, 2018 | DOI: 10.1007/s10535-018-0773-8

Root cortical aerenchyma (RCA) is suggested to reduce metabolic cost for root growth, but it might lower water uptake by plants. The objective of this work was to evaluate the effects of drought and phosphorus on the RCA development along the root axis and to elucidate its role in water stress tolerance of two maize genotypes. Plants of drought-tolerant DKB390 and drought-sensitive BRS1010 genotypes were grown in Vermiculite at field capacity of 100, 75, 50, and 25 % and supplied with 0.1, 0.4, and 0.8 mM phosphorus. Growth parameters, RCA, and plant P content were evaluated for all plants. Higher RCA development was observed in DKB390 than in BRS1010. Drought reduced the percentage of RCA in the root-hair zone of both genotypes but increased its development in the root maturation zone. Phosphorus limitation enhanced RCA development only in the DKB390. Under drought stress, DKB390 showed resilient growth whereas growth was inhibited in BRS1010. Higher root P content was related to its higher supply. Therefore, RCA formation was induced either by drought or by phosphorus limitation, while no interaction was evident. The RCA development varied along the root axis in order to balance water and phosphorus uptake and the drought response was genotype dependent.

Mapping QTLs for chlorophyll content and chlorophyll fluorescence in wheat under heat stress

N. Bhusal, P. Sharma, S. Sareen, A. K. Sarial

Biologia plantarum 62:721-731, 2018 | DOI: 10.1007/s10535-018-0811-6

Heat stress, one of the major abiotic stresses in wheat, affects chlorophyll fluorescence and chlorophyll content and thereby photosynthesis. To identify quantitative trait loci (QTLs) associated with these traits under terminal heat stress, 251 recombinant inbred lines (RILs) derived from a cross HD 2808/HUW510 were phenotyped. Using composite interval mapping, 40 QTLs were identified; 17 were related to conditions after timely sowing and 23 to heat stress after late sowing. The various parameters of chlorophyll fluorescence were associated with 23 QTLs, which were located on chromosomes 1A, 2A, 3A, and 2D and explained 3.67 to 18.04 % of phenotypic variation, whereas chlorophyll content was associated with 17 QTLs on chromosomes 2A, 2B, 2D, 5B, and 7A explaining 3.49 to 31.36 % of phenotypic variation. Most of the identified QTLs were clustered on chromosome 2D followed by 2A and 1A. The QTL Qchc.iiwbr-2A for chlorophyll content linked with marker gwm372 was stable over conditions and explained 3.81 to 18.05 % of phenotypic variation. In addition, 7 epistatic QTL pairs were also detected which explained 1.67 to 11.0 % of phenotypic variance. These identified genomic regions can be used in marker assisted breeding after validation for heat tolerance in wheat.

High irradiance sensitive phenotype of Arabidopsis hit2/xpo1a mutant is caused in part by nuclear confinement of AtHsfA4a

H.-Y. Huang, K.-Y. Chang, S.-J. Wu

Biologia plantarum 62:69-79, 2018 | DOI: 10.1007/s10535-017-0753-4

In Arabidopsis, EXPORTIN1A (HIT2/XPO1A) and EXPORTIN1B (XPO1B) mediate the translocation of nuclear export sequence (NES)-bearing proteins from nucleus to cytoplasm. However, a mutation in HIT2/XPO1A but not in XPO1B induces sensitivity to high irradiance (HI). Arabidopsis thaliana heat stress elements A4a and A5 (AtHsfA4a and AtHsfA5) are involved in plant responses to HI and possess NESs; therefore, their nucleo-cytoplasmic partitioning was analyzed. In wild-type and xpo1b mutant cells, AtHsfA4a normally remained in the cytoplasm but became concentrated in the nucleus following exposure to HI, whereas AtHsfA5 was constitutively distributed in both cytoplasm and nucleus. However, in hit2/xpo1a mutant, AtHsfA4a and AtHsfA5 were always confined to the nucleus, regardless of the irradiance. Although AtHsfA4a can enhance the ability of plants to scavenge H2O2, and AtHsfA5 is a repressor of AtHsfA4a, athsfa5 but not athsfa4a mutant plants exhibited HI sensitivity. Additionally, athsfa4a plants expressing AtHsfA4aΔNES were sensitive to HI, but athsfa5 plants expressing AtHsfA5ΔNES were not. Meanwhile, hit2/athsfa4a double mutant was more tolerant to HI than hit2. These results indicate that both AtHsfA4a and AtHsfA5 were HIT2/XPO1A-specific substrates. Long-term accumulation of AtHsfA4a contributed to the hit2 HI-sensitive phenotype independent of the scavenging ability of H2O2, and the presence of AtHsfA5 could mitigate this adverse effect.

Anatomy and photosystem II activity of in vitro grown Aechmea blanchetiana as affected by 1-naphthaleneacetic acid

J. P. R. Martins, L. C. A. Rodrigues, E. R. Santos, B. G. Batista, A. B. P. L. Gontijo, A. R. Falqueto

Biologia plantarum 62:211-221, 2018 | DOI: 10.1007/s10535-018-0781-8

Auxins are one of the main regulators of in vitro plant growth and development. However, the mechanisms, by which auxins, such as 1-naphthaleneacetic acid (NAA), affect in vitro root and leaf anatomy and photosystem function, remain unclear. Accordingly, the aim of the present study was to analyze the effect of different NAA concentrations on the anatomy and photosynthetic performance of in vitro-propagated Aechmea blanchetiana and to determine whether such a treatment affects micropropagated plants after acclimatization. In vitro-established A. blanchetiana plants were transferred to culture media that contained 0, 2, 4, or 6 μM NAA, and after 50 d, they were transplanted into plastic seedling trays with a commercial substrate and cultivated for 60 d in a greenhouse. The plants were evaluated after a 50-d in vitro NAA exposure (growth traits, chlorophyll α fluorescence, and root and leaf anatomy) and after 60 d of acclimatization in the greenhouse (root and leaf growth). Changes induced by NAA in root anatomy might improve uptake of minerals and sugars from the medium, thereby increasing the in vitro growth. In the leaves, the lowest chlorenchyma thickness and sclerenchyma area were observed in plants grown without NAA, and NAA exposure also improved photosystem II activity. The highest ex vitro growth rate was observed for plants that were propagated with 4 μM NAA. Therefore, the use of NAA during in vitro propagation can improve the anatomical and physiological quality of A. blanchetiana plants, as well as to improve ex vitro transfer.

Brassinosteroids and iron plaque affect arsenic and cadmium uptake by rice seedlings grown in hydroponic solution

B. Xu, J. Y. Yu, T. Xie, Y. L. Li, M. J. Liu, J. X. Guo, H. L. Li, Y. Yu, C. Y. Zheng, Y. H. Chen, G. Wang

Biologia plantarum 62:362-368, 2018 | DOI: 10.1007/s10535-018-0784-5

Brassinosteroids (Brs) have drawn wide attention due to their protective role against toxicity of heavy metals in plants. To better understand the role of Br in arsenic (As) and cadmium (Cd) uptake by rice plants, a hydroponic experiment was conducted to investigate the combined effect of 24-epibrassinolide (Br24) or 28-homobrassinolide (Br28) and iron plaque (IP) on As and Cd uptake and accumulation in rice seedlings. Six-week-old seedlings were sprayed with 0.2 or 0.02 μM Br24 or Br28 and grown in nutrient solution for 3 d, and then 20 or 60 mg Fe2+ dm-3 (Fe20 and Fe60) was used to induce root IP formation for 3 d. These seedlings with or without Br and with or without IP were exposed to solution containing 0.5 mg dm-3 AsIII or Cd for 9 d. The results showed that rice growth decreased when Br24 were applied, but it increased when combination of Br24 and IP was applied. Fe concentrations in dithionite-citratebicarbonate (DCB) extracts were increased after 0.2 or 0.02 μM Br24 application in the absence of IP, but decreased by Br24 in the presence of IP. In the absence of IP, As and Cd content in leaves was significantly reduced by 0.02 μM Br24 and 0.2 μM Br28, respectively. The As content in leaves was also reduced by the combination of 0.02 and 0.2 μM Br28 and IP, and the Cd content in leaves was reduced by the combined effect of 0.2 μM Br24 and IP. These results indicate that Br24 and Br28 could impede As and Cd accumulation, and the interactions between Br and IP may have a potential in restricting the transport of As and Cd into rice shoots.

Expression of rice OsMyb4 transcription factor improves tolerance to copper or zinc in canola plants

G. N. Raldugina, M. Maree, M. Mattana, G. Shumkova, S. Mapelli, V. P. Kholodova, I. V. Karpichev, V. V. Kuznetsov

Biologia plantarum 62:511-520, 2018 | DOI: 10.1007/s10535-018-0800-9

The effects of copper and zinc salts on transgenic canola plants expressing rice transcription factor (TF) OsMYB4 were investigated. Transgenic plants (TPs), which showed a high OsMyb4 expression in response to either Cu or to Zn excess, were used for the current study. In leaves of TPs, the content of Cu was equal and the content of Zn was significantly higher than in non-transformed plants (NTPs). The TPs grown on an extremely high concentration of heavy metals (HMs; 150 μМ CuSO4 or 5 000 μМ ZnSO4) were able to survive for more than 15 d, while NTPs died after 7 - 9 d of incubation. This indicates that expression of OsMyb4 in canola plants improved their HM tolerance. The TPs tolerance to HMs was confirmed by a higher shoot biomass than that in NTPs. Excess of HMs caused oxidative stress (indicated by increase in malondialdehyde content) especially in leaves of NTPs. This data suggests a protective role of the OsMyb4 TF in oxidative stress. The HMs caused a lower decrease in activities of superoxide dismutase and guaiacol peroxidase in TPs than in NTPs. Higher tolerance of TPs to HMs was also suggested by a considerable increase in the content of low-molecular phenolic compounds, including flavonoids and anthocyanins, as well as proline (a potential antioxidant and chaperone). These data suggest that OsMYB4 may play a role as a positive regulator of phenylpropanoid pathway and proline synthesis. The created canola OsMyb4 TPs may be useful for future applications in phytoremediation of HM-polluted soils.

Gibberellin A3 as an epigenetic determinant of global DNA hypo-methylation in tobacco

R. Manoharlal, G. V. S. Saiprasad, C. Ullagaddi, A. Kovaøík

Biologia plantarum 62:11-23, 2018 | DOI: 10.1007/s10535-017-0738-3

Gibberellins (GAs) are a large family of tetracyclic diterpenoids, controlling important aspects of growth and development throughout the plant life cycle. To explore the possibility that gibberellin A3 (GA3) signalling induces epigenetic alteration(s), we carried out a field experiment study using Nicotiana tabacum as a model system. The GA3 application on leaves resulted in increased plant-height, foliage density, leaf cell area, and trichome density. The plants exposed to GA3 also exhibited: 1) increased chromatin de-condensation, 2) reduced global DNA methylation, 3) reduced DNA methyltransferases (NtDNMTs) activities accompanied by decreased amounts of NtMET1 and NtCMT3 transcripts, and 4) partial restoration of phenotype and expression of epigenetically silenced reporter transgene. Based on these observations, we propose that GA3 application induces complex epigenetic re-programming, which may lead to distinct developmental phenotypes. These results could provide an important insight for future studies on epigenetic mechanism(s) in other important crops.

Changes in leaf tissue of Carica papaya during single and mixed infections with Papaya ringspot virus and Papaya mosaic virus

M. A. García-Viera, L. Sánchez-Segura, G. Chavez-Calvillo, D. Jarquín-Rosales, L. Silva-Rosales

Biologia plantarum 62:173-180, 2018 | DOI: 10.1007/s10535-017-0741-8

Papaya (Carica papaya L.) is susceptible to viral diseases caused by Papaya mosaic virus (PapMV) and Papaya ringspot virus (PRSV), which limit fruit production and affect economic yield. The symptoms produced by both the viruses are similar in early stages of infection and include vein and leaf chlorosis, which develop into mosaic at later stages of infection when leaf lamina can get reduced in size and distorted with a shoe-string aspect. Digital image analyses, such as fractal dimension (FD) and lacunarity (λ) were used here to examine papaya tissue after single and mixed infections of PRSV and PapMV. Morphological changes, such as hypoplasia, hyperplasia, and neoplasia are described in tissues with viral infections. Furthermore, we quantified these changes and suggest three ranges of tissue damage according to their λ values in rank 1 (0.01 to 0.39), rank 2 (0.4 to 0.79), and rank 3 (0.8 to 1). Our analyses suggest that in synergism and antagonism there is a competition of both viruses to occupy the same mesophyll cells, as indicated by their intermediate values of lacunarity.

Characterization and primary functional analysis of Pinus densata miR171

B. Z. Hai, Z. B. Qiu, Y. Y. He, M. M. Yuan, Y. F. Li

Biologia plantarum 62:318-324, 2018 | DOI: 10.1007/s10535-018-0774-7

The miR171 is a conserved microRNA (miRNA) family and has been shown to participate in plant growth and development. However, the precise function of miR171 in Pinus densata remains largely unclear. Mature miR171 sequence comparison reveals high similarity between Arabidopsis thaliana and P. densata and the pre-miR171 could fold into a characteristic stem-loop hairpin structure. Genes encoding GRAS (GAI-RGA-SCR) family transcription factors and actin binding protein were identified as targets of pde-miR171 using a modified RNA ligase mediated 5' rapid amplification of cDNA ends (RLM-RACE). Furthermore, the interaction between pde-miR171 and Arabidopsis SCL6 (SCARECROW-LIKE6) was further validated through transient co-expression of both genes in Nicotiana benthamiana leaves. Next, results of real-time quantitative PCR demonstrated that the expression of pde-miR171 was significantly up-regulated in miR171-overexpressing plants than in wild-type plants, which was inversely correlated with the expression of Arabidopsis SCL6 genes. In addition, overexpression of pde-miR171 in Arabidopsis induced larger leaves and earlier flowering under long-day conditions compared with the wild type. The findings presented here suggest that miR171 derived from a P. densata precursor together with its target gene SCL6 may play important roles in the regulation of primary root growth, leaf shape, and flowering time in plants.

Heterologous expression of a novel Poa pratensis gibberellin 2-oxidase gene, PpGA2ox, caused dwarfism, late flowering, and increased chlorophyll accumulation in Arabidopsis

P.-H Tan, L. Zhang, S.-X. Yin, K. Teng

Biologia plantarum 62:462-470, 2018 | DOI: 10.1007/s10535-018-0788-1

Gibberellin 2-oxidases (GA2oxs) irreversibly convert bioactive gibberellins (GAs) and their immediate precursors into inactive GAs via 2-β hydroxylation and so regulate gibberellin content in plants. However, to the best of our knowledge, little has been known about the GA2oxs and its function in cool season turfgrass Poa pratensis. In this study, rapid amplification of cDNA end (RACE) was employed to isolate PpGA2ox from P. pratensis. The open reading frame of PpGA2ox was 1 047 bp in length, corresponding to 348 amino acids. PpGA2ox was localized in both nucleus and cytoplasm. The expression of PpGA2ox could be up-regulated by 10 μM gibberellic acid, 5 μM methyl jasmonate, or 10 μM indole-3-acetic acid. In addition, its native promoter could drive GUS expression in both leaf apex and shoot apical region. Moreover, overexpression of PpGA2ox in Arabidopsis led to GA-deficiency leading to dwarf phenotype, delayed flowering time, and increased chlorophyll content. Our study suggests that PpGA2ox could be a candidate gene for breeding new cultivars of P. pratensis.

The role of plant cation/proton antiporter gene family in salt tolerance

Q. Jia, C. Zheng, S. Sun, H. Amjad, K. Liang, W. Lin

Biologia plantarum 62:617-629, 2018 | DOI: 10.1007/s10535-018-0801-8

Salinity is one of the major abiotic constraints to agriculture. The physiological and molecular mechanisms of salt tolerance have been studied in plants for many years. The regulation of osmosis and ion homeostasis is crucial. A lot of important components involved in plant responses to salt stress have been identified. Among them, ion transporters and channels take an essential role in ion homeostasis, mainly for Na+, Cl-, and K+. Until now, many cation antiporters important for salt tolerance in plants have been characterized. Among them, the monovalent cation/proton antiporters (CPA) family is one of the most important families, including sodium proton exchangers (NHXs), K+-efflux antiporters (KEAs), and cation/H+ exchangers (CHXs). Here, the current knowledge of the plant CPA family in responses to salt stress was reviewed. The regulation mechanisms were also included and discussed.

Effects of zinc oxide nanoparticles on the growth, photosynthetic traits, and antioxidative enzymes in tomato plants

X. P. Wang, Q. Q. Li, Z. M. Pei, S. C. Wang

Biologia plantarum 62:801-808, 2018 | DOI: 10.1007/s10535-018-0813-4

With the dramatic increase in nanotechnologies, it has become probable that biological systems will be exposed to excess of nanoparticles (NPs). However, the impact of NPs on plants, remains to be explored. The aim of this research was to determine the effects of ZnO NPs on tomato (Solanum lycopersicum L.) plants. Plant growth, photosynthetic characteristics, chlorophyll fluorescence parameters, and activities of antioxidative enzymes were measured in 35-d-old plants. The ZnO NP treatments significantly inhibited tomato root and shoot growth, decreased the content of chlorophylls a and b, and reduced photosynthetic efficiency and some other chlorophyll fluorescence parameters in a concentration-dependent manner. However, the supernatant of ZnO NP suspensions did not affect growth of tomato, despite the presence of small amounts of Zn2+. Taken together, these results suggest that toxic effects on tomato plants were from ZnO NPs, not from Zn2+ released into the solution; toxicity was likely caused by reduced chlorophyll content and damaged photochemical system, which in turn limited photosynthesis and led to the reduction in biomass accumulation. Also, ZnO NPs enhanced the transcription of genes related to antioxidant capacity, suggesting that ZnO NPs could enhance the defence response by increasing activities of antioxidant enzymes.

Mobilization of the Tetu1 transposable element of Helianthus annuus: evidence for excision in different developmental stages

M. Fambrini, C. Pugliesi

Biologia plantarum 61:55-63, 2017 | DOI: 10.1007/s10535-016-0655-x

The tubular ray flower (turf) mutant of sunflower is characterized by a switch of ray flowers from zygomorphic to near-actinomorphic disc flowers. In sunflower, floral symmetry of ray and disc flowers is specified by the activity of members of a CYCLOIDEA (CYC) gene family. The turf mutant is generated by the insertion of a CACTA-like transposable element (TE), named Transposable element of turf1 (Tetu1), in the coding sequence of the HaCYC2c gene. The TEinsertion changes the reading frame of turf-HaCYC2c for the encoded protein and leads to a premature stop codon. Tetu1 is a non-autonomous version of a CACTA TEcarrying the minimum sequences necessary for transposition in the presence of autonomous elements in the sunflower genome. In the previous analysis, performed in more than 11 000 plants homozygous for the turf-HaCYC2c allele, the absence of chimerism and the segregation rate of derived-progenies from reverted phenotypes suggest that Tetu1 transpositions are restricted to a time shortly before and/or during meiosis. Here, we report the analysis of F5 and F6 progenies, derived from an F4 progeny of the cross turf × Chrysanthemoides2, where plants with a chimeric inflorescence were detected. Tetu1 showed active excision in all progenies taken into consideration and named High Frequency of Tetu1 Transposition (HFTT). Within a total of 449 plants, Tetu1 excision generated a 13.81 % of non-chimeric revertants but also a 5.12 % of plants with somatic sectors of variable size in the outmost whorl of the inflorescence. These unexpected results suggest variations in tissue specificity and time of TEexcision. The excision of Tetu1 was confirmed by DNA molecular screening of non-chimeric and chimeric revertants and transcription analysis of the HaCYC2c gene. In HFTT progenies, sequence analyses excluded significant DNA changes with respect to the original Tetu1 transposon as well as to the adjacent 5'- and 3'-TE regions. Genetic and epigenetic regulatory mechanisms were proposed to explain the time and frequency of Tetu1 transposition in HFTT progenies.

Tolerance to soil water stress by Oryza sativa cv. IR20 was improved by expression of Wsi18 gene locus from Oryza nivara

R. Kaur, A. Chakraborty, R. K. Bhunia, S. K. Sen, A. K. Ghosh

Biologia plantarum 62:129-139, 2018 | DOI: 10.1007/s10535-017-0742-7

Wild rice genotypes are rich in genetic diversity. This has potential to improve agronomic rice by allele mining for superior traits. Late embryogenesis abundant (LEA) proteins are often associated with desiccation tolerance and stress signalling. In the present study, a group 3 LEA gene, Wsi18 from the wild rice Oryza nivara was expressed under its own inducible promoter element in stress susceptible cultivated indica rice (cv. IR20). The resulting transgenic plants cultivated in a greenhouse showed enhanced tolerance to soil water deficit. Transgenic plants had higher grain yield, plant survival rate, and shoot relative water content compared to wild type (WT) IR20. Cell membrane stability index, proline and soluble sugar content were also greater in transgenic than WT plants under water stress. These results demonstrate the potential for improving SWS tolerance in agronomically important rice cultivar by incorporating Wsi18 gene from a wild rice O. nivara.

Mechanisms of heat sensing and responses in plants. It is not all about Ca2+ ions

M. Sajid, B. Rashid, Q. Ali, T. Husnain

Biologia plantarum 62:409-420, 2018 | DOI: 10.1007/s10535-018-0795-2

The climate shift has resulted in frequent heat waves, which cause damaging effects on plant growth and development at different life stages. All cellular processes in plants are highly sensitive to a high temperature. The plasma membrane heat receptors usually sense temperature variations directly or via a change in membrane fluidity. The accumulation of damaged proteins and reactive oxygen species also aid in heat perception. Calcium ions and heat sensors transfer signals to transcription factors through a series of signaling cascades. The heat stress transcription factors (HSFs) effectively regulate expression of heat induced genes. The members of the heat shock transcription factor A1 (HsfA1s) family are master regulators of a heat stress response. Different HSFs interact with each other at different levels and simultaneously operate heat induced gene expression. Interaction of HSFs with each other on multiple levels provides chances for manipulation to improve plant heat stress tolerance.

Expression and characteristics of rice xylanase inhibitor OsXIP, a member of a new class of antifungal proteins

R.-J. Sun, Y. Xu, C.-X. Hou, Y.-H. Zhan, M.-Q. Liu, X.-Y. Weng

Biologia plantarum 62:569-578, 2018 | DOI: 10.1007/s10535-018-0787-2

It has been hypothesized that xylanase inhibitors play important roles in plant defense against microbial pathogens. Currently, there is little information available about xylanase inhibitor OsXIP in rice and its gene expression. We cloned a xylanase inhibitor gene OsXIP from rice (Oryza sativa L. cv. Nipponbare) genomic DNA. To determine the function of OsXIP, we generated OsXIP-overexpressing transgenic rice plants. The transgenic plants had significantly higher OsXIP expression and showed enhanced defense response to Magnaporthe oryzae compared to the wild-type plants. The results also showed that the increased OsXIP expression was accompanied by the up-regulation of pathogenesisrelated genes. To clarify the OsXIP expression pattern, a ProOsXIP::GUS vector was constructed and transgenic plants were obtained. GUS staining results revealed that OsXIP showed organ-specific expressions in rice plants. OsXIP was primarily expressed in the roots and in the veins, but it was weakly expressed in the leaves. Analyses of the OsXIP expression in response to biotic and abiotic stresses indicated that it was drastically induced by biotic stresses and methyl jasmonate treatment. OsXIP, a member of a new class of antifungal proteins, may function as a barrier that prevents the cell wall degradation by xylanases excreted by fungal pathogens. The OsXIP was found to be a stressresponsive gene and it could take part in plant defense via a JA-mediated signaling pathway.

Knockout mutants of Arabidopsis thaliana β-galactosidase. Modifications in the cell wall saccharides and enzymatic activities

M. Moneo-Sánchez, L. Izquierdo, I. Martín, J. Hernández-Nistal, L. Albornos, B. Dopico, E. Labrador

Biologia plantarum 62:80-88, 2018 | DOI: 10.1007/s10535-017-0739-2

This work studied the six β-galactosidases (BGALs) of the subfamily a1 of Arabidopsis, that have been proposed to play important roles in the cell wall remodelling during plant development, although their precise functions are still unknown. Knockout mutants bgal1, bgal2, bgal3, bgal4, bgal5, and bgal12 of Arabidopsis and their wild type (WT) plants were analysed to determine their morphology and composition of their cell walls. The gas chromatography and the Fourier transform infrared spectroscopy revealed differences between the mutants and their WT such as in the proportions of glucose, galactose, or xylose in bgal2 and bgal4 and in cell walls polysaccharides in bgal1, bgal3, and bgal5. However, these slight changes did not result in morphological variations during plant development. None of the mutant seedlings displayed a clear reduction in β(1,4)-galactan content, analysed by immunolocalization. The absence of significant phenotypic changes in the β-galactosidase subfamily a1 mutants could indicate possible β-galactosidases functional redundancy. Future studies will focus on the construction of multiple mutants that help to establish the precise function of each member of the β-galactosidase subfamily a1.

Comprehensive isolation and expression analysis of the flavonoid biosynthesis-related genes in Tricyrtis spp.

M. Otani, Y. Kanemaki, F. Oba, M. Shibuya, Y. Funayama, M. Nakano

Biologia plantarum 62:684-692, 2018 | DOI: 10.1007/s10535-018-0802-7

Tricyrtis spp., which belong to the family Liliaceae, produce unique flowers, whose tepals have many reddish-purple spots. Although elucidation of a molecular mechanism of tepal spot formation and molecular breeding for flower colour alteration are desired for Tricyrtis spp., only one flavonoid biosynthesis-related gene, TrCHS encoding chalcone synthase (CHS), has been isolated so far. In the present study, comprehensive isolation and expression analysis of the other flavonoid biosynthesis-related genes were carried out in Tricyrtis sp. Six genes (TrCHI, TrF3H, TrF3'H, TrFLS, TrDFR, and TrANS) encoding biosynthetic enzymes chalcone isomerase (CHI), flavanone-3-hydroxylase (F3H); flavonoid 3'-hydroxylase (F3'H), flavonol synthase (FLS), dihydroflavonol 4-reductase (DFR), and anthocyanin synthase (ANS) as well as three genes (TrMYB1, TrbHLH2 and TrWDR) encoding transcription factors myeloblastosis 1 (MYB1), basic helix-loop-helix (bHLH), and WD40 repeats (WDRs) were newly isolated. Phylogenetic analysis showed that each isolated gene was classified into the monocotyledonous clade. Deduced amino acid sequences of DFRs showed that TrDFR has no substrate specificity. "Early" genes in the flavonoid biosynthetic pathway (TrCHS, TrCHI, and TrF3H) were constantly expressed in tepals during flower development, whereas expression of "late" genes (TrF3'H, TrFLS, TrDFR, and TrANS) varied with the flower developmental stage. Expression patterns of the late genes were mostly correlated with those of transcriptional factor genes, indicating that the late genes may be under the control of a transcription factor complex consisted of TrMYB1, TrbHLH2, and TrWDR. Accumulation of anthocyanins in tepals occurred slightly after transcriptional upregulation of the late genes. Results obtained in the present study may be valuable for further studies on flower colour and flower colour pattern in Tricyrtis spp.

A novel potato microRNA stu-miR856 regulates mitogen-activatedprotein kinase genes contributing to drought tolerance

J.W. YANG, X. ZHU, S.G. LI, X. TANG, N. ZHANG, H.J. SI

Biologia plantarum 63:618-626, 2019 | DOI: 10.32615/bp.2019.067

Mitogen-activated protein kinases (MAPKs) are significant components of MAPK cascades, which play versatile roles in different transduction pathways to mediate stress adaptation. However, little information is known about post-transcriptional regulation of MAPK genes in plant under drought stress. MicroRNAs (miRNAs), a class of newly identified, short non-coding RNAs, regulate the expression of target genes in plant growth, development, and stress responses. In order to investigate the mechanism of miRNA regulating MAPK genes in potato, we identified a novel potato miRNA with the sequence CGGCCTTAATAAGATGGTGAAG and named it as stu-miR856 depending on miRNA deep sequencing and bioinformatic analysis. Target prediction indicates that it can bind to the coding sequence region of two potato MAPK-like genes, and cleavage positions of them were also effectively validated by RNA ligase-mediated 5' rapid amplification of cDNA ends assay. In addition, expressional analysis shows that stu-miR856 and its targets exhibited an opposite expression pattern: stu-miR856 expression significantly decreased while its target genes greatly increased in the different stages of drought treatment. The results indicate that a decreased expression of stu-miR856 might drive overexpression of two StMAPK genes family members, which may contribute to regulation of the drought adaptation of potato plants.

MicroRNA319 family members play an important role in Solanum habrochaites and S. lycopersicum responses to chilling and heat stresses

X.P. Shi, F.L. Jiang, J.Q. Wen, S.Y. Cui, Y.Z. Zhou, Z. Wu

Biologia plantarum 63:200-209, 2019 | DOI: 10.32615/bp.2019.023

The microRNA319 (miR319) family is involved in plant development and responses to abiotic stresses. Previous work showed that miR319 responded to chilling stress in the chilling-tolerant wild tomato (Solanum habrochaites L.) genotype LA1777. Here, the precursors of sha-miR319a, b, c, and d were cloned from LA1777 and the putative target genes tosinte branched/cycloidea/proliferating cell factors (TCP3 and TCP29) were validated using 5′-RLM-RACE. Expression patterns revealed a negative correlation of sha-miR319 with TCP3 and TCP29 in LA1777. Four tomato (S. lycopersicum) genotypes with varying sensitivities to chilling and heat stresses were selected to characterize expression patterns of miR319 and target genes under extreme temperatures. The involvement of miR319 in the chilling tolerance of tomato might be mediated by the repression of TCP3 and TCP29 expression. Initial stages of heat stress resulted in the up-regulation of miR319a, b, and d and led to a decrease in TCP3, TCP29, and TCP2 expression, whereas the down-regulation of miR319c in the later stages of heat stress may have been responsible for the subsequent up-regulation of TCP3, TCP29, and TCP2. Cis-elements found in the promoter regions of the miR319 family members indicated a potential role of miR319 in the regulation of stress tolerance and development processes. This study provides insights into the role of miR319-mediated regulatory mechanisms in responses to temperature stress in tomato genotypes.

 previous    1   2   3   4   5   6  7   8   9   10   11   ...    next