Since 1960, the positive effects of rare earth elements (REE) on crop physiology have been observed, and support for photosynthesis, biomass accumulation, secondary metabolites, or enzymes has been reported in 40% of studies. A higher content of chlorophylls a and b as well as carotenoids have been found along with an increased efficiency of photosystem II photochemistry and electron transfer rates. An increased activity of a key photosynthetic enzyme was also found in several plants growing in soil with a higher content of REE. An appropriate amount of REE also activates the antioxidant activity of peroxidase, superoxide dismutase, and catalase. These enzymes, together with a higher content of flavonoids and carotenoids, increase the resistance of plants to oxidative stress caused by different abiotic stresses. The positive effect of REE on biomass accumulation was also confirmed, but their affection on mycorrhizal symbiosis remains ambiguous. On the other hand, an excess of REE leads to damage to plants including the chloroplast ultrastructure. Therefore, the positive and negative effects of REE remain controversial, and the mechanisms of effects of REE in plants remain poorly understood. In addition to physiological processes, the absorption, bioavailability, and translocation of REE in plants as well as their possible ecotoxicology and hyperaccumulation are discussed in this review.

The roles of ethylene responsive factors (ERFs) and their positive and negative regulations of abiotic stress tolerance have been widely reported. This study reports the characterization of ItERF from Iris typhifolia Kitag with respect to molecular and functional properties. The 867 bp cDNA fragment of ItERF was cloned by reverse transcription PCR from I. typhifolia. Real-time quantitative PCR revealed that ItERF expression was induced in the roots, stems, and leaves of I. typhifolia after NaCl treatment, and that ItERF expressions were significantly higher in the leaves and roots than in the stems. A green fluorescent protein marker revealed that ItERF was located to the nucleus. Plant survival and root growth of ItERF transgenic Arabidopsis thaliana L. seedlings were much better than those of the wild type under NaCl stress. Malondialdehyde content in the transgenic lines was significantly lower than that in the wild type. Growth of yeast transformants showed an enhanced tolerance to salt stress than non-transformed yeast cells. All of the results verified that the expression of ItERF had effects on plant growth under salt stress.

Salinity adversely affects plants resulting in disruption to plant growth and physiology. Previously, it has been shown that these negative effects can be alleviated by various exogenous polyamines. However, the role of spermidine (Spd) in conferring salinity tolerance in sorghum is not well documented. The effect of exogenous Spd on the responses of sweet sorghum (Sorghum bicolor L.) seedlings to salt stress (150 mM NaCl) was investigated by measuring photosynthetic carbon assimilation, Calvin cycle enzyme activities, and the the expression of respective genes. Application of 0.25 mM Spd alleviated the negative effects of salt stress on efficiency of photosystem II and CO₂ assimilation and increased the activities of ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco) and aldolase. Salt stress significantly lowered the transcriptions of genes encoding Rubisco large subunit, Rubisco small subunit, 3-phosphoglyceric acid kinase, glyceraldehyde-3-phosphate dehydrogenase, triose-3-phosphate isomerase, fructose-1,6-bisphosphate aldolase, fructose-1,6-bisphosphate phosphatase, and sedoheptulose-1,7-bisphosphatase. However, transcriptions of genes encoding phosphoribokinase and Rubisco were up-regulated. The Spd application enhanced expressions of most of these genes. It appears Spd conferred salinity tolerance to sweet sorghum seedlings by enhancing photosynthetic efficiency through regulation of gene expressions and activities of key CO₂ assimilation enzymes.

Plant hormones play important roles in seed dormancy and dormancy breaking. We measured the hormone content in rice (Oryza sativa L. cv. Nona Bokra) seeds at different stages and with or without imbibition treatment. We identified 1 265 differentially expressed genes (DEGs) between dormant and dormancy-broken seeds using RNA-seq analysis: 1 015 genes were significantly up-regulated, while 250 genes were significantly down-regulated. Sixteen DEGs were selected as related to seed dormancy, and their expressions were validated using quantitative PCR. Three DEGs were in the same position as two reported dormancy QTLs, suggesting that they may be candidate genes that control the dormancy of rice seeds. Our study provides an important basis for cloning genes in dormant rice seeds and provides theoretical support for the study of the dormancy mechanism.

Circular RNAs (circRNAs), an emerging class of non-coding RNAs, are abundant in eukaryotic transcriptomes. Seed germination is one of the most important stages in the entire life cycle of plants that can be slowed down or totally restrained by high temperature. Our aim is to identify heat-responsive circRNAs and explore the potential function of circRNAs in tomato seeds at high temperature. Following high-throughput sequencing, 4 164 circRNAs were identified, and 980 circRNAs were shared in the control and high-temperature libraries. Among the 748 circRNAs with high expressions, 73 circRNAs were significantly up-/down- regulated in tomato seeds germinated at high temperature compared to the control. The parental genes of circRNAs existing in seeds only at high temperature were mainly involved in metabolic processes, cellular processes, catalytic activities, and binding based on Gene Ontology analysis. The results suggested that circRNAs were widespread in tomato and were generated from different chromosomes and diverse genomic regions. Some circRNAs in tomato seeds responded to high temperature during germination. This study provides the first genome-wide profile of circRNAs in response to high temperature during tomato seed germination and lays a foundation for studying the potential biological functions of circRNAs responding to heat stress.

The "Specific Tissue" (ST) are proteins of unknown function present only in some plant families, mainly Fabaceae and Asteraceae. They are included in the PF10950 protein family and characterized by the presence of at least one domain of unknown function (DUF)2775. In this work we studied the involvement of the six members of the Medicago truncatula ST family (ST1 to ST6) in the development of flowers, fruits, and seeds by analysing the activity of their promoters (pST) after the construction of M. truncatula transgenic plants expressing the b-glucuronidase (GUS) reporter gene under the control of the six pSTs. The GUS activity was analysed in whole flowers and fruits and also in histological sections of these organs. The pST expression in the reproductive organs was mainly associated with the vascular bundles, especially throughout fruit development. These results pointed to an important role of ST proteins during the reproductive development stage, related to nutrient mobilization during the fruit and seed formation, that could be facilitated by their presence in the pod vascular bundles, as well as in the connective tissue of the anthers (ST3, ST4, ST6), in the placenta, the funiculus, and the outer parts of the developing seed (ST2, ST3, ST6). The observations made in this study were in agreement with the functions previously established for the three groups of M. truncatula ST proteins, as in the proposed function for ST1 in the transport and assimilation of nutrients, or the involvement of ST4, ST5, and ST6 in floral defence.

Mitogen-activated protein kinases (MAPKs) are significant components of MAPK cascades, which play versatile roles in different transduction pathways to mediate stress adaptation. However, little information is known about post-transcriptional regulation of MAPK genes in plant under drought stress. MicroRNAs (miRNAs), a class of newly identified, short non-coding RNAs, regulate the expression of target genes in plant growth, development, and stress responses. In order to investigate the mechanism of miRNA regulating MAPK genes in potato, we identified a novel potato miRNA with the sequence CGGCCTTAATAAGATGGTGAAG and named it as stu-miR856 depending on miRNA deep sequencing and bioinformatic analysis. Target prediction indicates that it can bind to the coding sequence region of two potato MAPK-like genes, and cleavage positions of them were also effectively validated by RNA ligase-mediated 5' rapid amplification of cDNA ends assay. In addition, expressional analysis shows that stu-miR856 and its targets exhibited an opposite expression pattern: stu-miR856 expression significantly decreased while its target genes greatly increased in the different stages of drought treatment. The results indicate that a decreased expression of stu-miR856 might drive overexpression of two StMAPK genes family members, which may contribute to regulation of the drought adaptation of potato plants.

Calmodulin-binding transcription activators (CAMTAs) play important roles in plant growth, developmental processes, and responses to abiotic and biotic factors. Recently, five CAMTA members were identified in Citrus sinensis, however, very little is known about the molecular regulation of these CAMTAs in citrus during fruit development and under abiotic stresses. In this study, the different expression profiles of CsCAMTA genes were found in different tissues and different fruit developmental stages. The CsCAMTA genes also displayed distinct expression patterns after heat, cold, salt, and drought stresses. Furthermore, the expressions of CsCAMTA genes were significantly induced by treatments with salicylic acid, methyl jasmonate, or abscisic acid. The green fluorescent protein gene fused with CsCAMTA was specifically expressed in the nucleus of Nicotiana benthamiana cells. Additionally, CsCAMTA proteins can activate or suppress DNA transcription in yeast. These findings provide helpful information for further studies of stress signals in citrus.

In non-heading Chinese cabbage, the yield relies mostly on the health of leaves, which can be heavily impacted by turnip mosaic virus (TuMV). The virions or viral ribonucleoprotein complexes are transported through the phloem and xylem. Plasmodesmata are indispensable because they traverse cell walls and connect companion cells, allowing virus particles long distance movement. However, which complexes and genes participate in this process is still unknown. Plants can activate defense mechanisms and apply disease resistance genes to respond to pathogen attacks. In this study, we collected the stems and petioles infected by TuMV for 7 d (TuMV-7), 14 d (TuMV-14), and 21 d (TuMV-21). Using isobaric tags for relative and absolute quantification-based proteomic technology, 6 043 distinct proteins were identified and 323, 240, 285, 203, 253, and 363 differentially expressed proteins were found in the comparable pairs of TuMV-7/control, TuMV-14/TuMV-7, TuMV-14/control, TuMV-21/TuMV-7, TuMV-21/TuMV-14, and TuMV-21/control, respectively. We performed a functional annotation analysis of all identified proteins and a functional enrichment analysis of all differentially expressed proteins. The results indicated that the long distance movement of TuMV involved many complex regulatory pathways. The respective proteins were related to those occurring in plasmodesmata and to Ca²⁺ transporters. Further, we also found proteins related to heat shock proteins, pathogenesis-related proteins, and proteins scavenging reactive oxygen species.

Plant defensins and defensin like protein (DEFL) form a large family of small cysteine-rich proteins. They are major components of plant immune systems, being involved in host defenses against biotic and abiotic stresses. In this study, a novel defensin like protein (DEFL) gene PnDEFL1 was isolated from Panax notoginseng, a traditional Chinese medicinal herb. The expression patterns of PnDEFL1 after treatment with methyl jasmonate, salicylic acid, ethephon, and H₂O₂, as well as during Fusarium solani infection, were analyzed using reverse transcription qPCR. The up-regulated expression of PnDEFL1 indicated that it responded to F. solani infection and all four defense-related signalling molecules. The PnDEFL1 gene was further fused with the green fluorescent protein gene in a plant expression vector and transformed into onion (Allium cepa) epidermal cells. The laser scanning confocal microscope confirmed that the PnDEFL1 protein localized to the extracellular region. In addition, the recombinant PnDEFL1 protein was expressed in Escherichia coli and purified by affinity chromatography. It had antifungal activities against F. solani, F. oxysporum, Botrosphaeria dothidea, and Sclerotinia sclerotiorum. The PnDEFL1 gene was transferred into tobacco (Nicotiana tabacum) to verify its function. The overexpression of PnDEFL1 in tobacco conferred a high resistance to F. solani infection. Thus, the PnDEFL1 gene is involved in the defense responses of P. notoginseng to F. solani infection.

Arabidopsis thaliana L. ecotype Dijon-G (Di-G) showed a different symptom development during pathogenesis compared to ecotype Columbia-0 (Col-0). Previously, it has been shown that Di-G has a higher susceptibility to necrotrophic fungus Alternaria brassicicola than Col-0. In this study, Di-G showed enhanced disease susceptibility to necrotrophic fungi Botrytis cinerea, Sclerotinia sclerotiorum, and Sclerotium rolfsii known to secrete oxalic acid (OA) as a pathogenicity factor. Treatment with 50 and 100 mM OA resulted in a more leaf tissue collapse in Di-G than in Col-0. The OA also up-regulated expression of the salicylic acid (SA)-inducible pathogenesis-related gene 1 (PR1) and down-regulated expression of the jasmonic acid/ethylene-inducible defensin PDF1.2 gene in Di-G. By contrast, Di-G was resistant to hemibiotrophic fungus Colletotrichum higginsianum and biotrophic Turnip crinkle virus (TCV) infections. Application of 0.5 mM SA resulted in a higher accumulation of endogenous SA and in a preferential expression of SA-responsive genes in Di-G. Salicylic acid accelerated OA-triggered plant cell death and attenuated PDF1.2 expression in Di-G. These results suggest that the enhanced susceptibility of Di-G to necrotrophic pathogen infections might be mediated by attenuated JA-ethylene defence signalling and/or heightened SA-related defence signalling. Interaction of SA-signalling with OA secretion might be also involved in the enhanced susceptibility of Di-G.

The microRNA319 (miR319) family is involved in plant development and responses to abiotic stresses. Previous work showed that miR319 responded to chilling stress in the chilling-tolerant wild tomato (Solanum habrochaites L.) genotype LA1777. Here, the precursors of sha-miR319a, b, c, and d were cloned from LA1777 and the putative target genes tosinte branched/cycloidea/proliferating cell factors (TCP3 and TCP29) were validated using 5′-RLM-RACE. Expression patterns revealed a negative correlation of sha-miR319 with TCP3 and TCP29 in LA1777. Four tomato (S. lycopersicum) genotypes with varying sensitivities to chilling and heat stresses were selected to characterize expression patterns of miR319 and target genes under extreme temperatures. The involvement of miR319 in the chilling tolerance of tomato might be mediated by the repression of TCP3 and TCP29 expression. Initial stages of heat stress resulted in the up-regulation of miR319a, b, and d and led to a decrease in TCP3, TCP29, and TCP2 expression, whereas the down-regulation of miR319c in the later stages of heat stress may have been responsible for the subsequent up-regulation of TCP3, TCP29, and TCP2. Cis-elements found in the promoter regions of the miR319 family members indicated a potential role of miR319 in the regulation of stress tolerance and development processes. This study provides insights into the role of miR319-mediated regulatory mechanisms in responses to temperature stress in tomato genotypes.

Osmanthus fragrans Lour., one of the top 10 most popular flowers in China, is known for both its beauty and fragrance. It is rich in flavonoids, a class of secondary metabolites with significant neuroprotective, free-radical scavenging, and anti-oxidant activity. To understand the mechanisms regulating flavonoid biosynthesis, we conducted transcriptome sequencing O. fragrans flowers to analyze gene expressions during the full flowering stage. The RNA was isolated separately from petals of cvs. Yingui and Dangui, which were treated or not with jasmonic acid, salicylic acid, or abscisic acid. A total of 142 029 unigenes were denovo assembled, and 50 918 unigenes were annotated. The differentially expressed genes were identified, annotated, and classified. The results of transcriptome sequencing and real-time PCR revealed higher expressions of phenylalanine ammonia-lyase (PAL), PAL1, chalcone synthase (CHS), flavanone-3-hydroxylase (F3H), flavonol synthase (FLS), and lower expressions of dihydroflavonol-4-reductase (DFR), anthocyanidin synthase (ANS) in 'Yingui' than in 'Dangui'. Such an expression pattern facilitated the higher accumulation of flavonoids in 'Yingui'. Several genes of the flavonoid biosynthesis pathway were upregulated by jasmonic acid and salicylic acid in both the cultivars leading to flavonoid accumulation in their petals. In the v-myb avian myeloblastosis viral oncogene homolog 1(MYB1)-overexpressing petals, the expressions of PAL, PAL1, CHI, and FLS increased. The results suggest that MYB1 may participate in the flavonoid biosynthesis pathway and regulate the expression of some upstream genes in O. fragrans.

Several studies revealed the important contribution of calcineurin B-like (CBLs) and CBL-interacting kinase (CIPKs) genes in transmitting stress signals in plants. Taking advantage from the genome sequences of the cultivated potato Solanum tuberosum and its wild relatives S. commersonii and S. chacoense, we identified for the first time 10 CBLs and 26 CIPKs genes in each species. The CBLs and CIPKs derived from tandem duplications indicate that these gene families in potato mainly arise through amplification mechanisms. Once annotated, we compared the par excellence model of Arabidopsis thaliana with S. commersonii, the potato model species for studying cold tolerance. We found that four ScCBL proteins (ScCBL1, ScCBL4a, ScCBL4b, and ScCBL9) started with a conserved N-myristoylation motif (MGXXXS/T), which might function in membrane targeting of the CBLs-CIPKs complex. Additionally, expression analyses of S. commersonii CBL and CIPK genes based on RNAseq revealed diverse expression patterns following various abiotic and biotic stresses and in the four tissues analyzed (flowers, leaf, roots, and tubers). Data also suggest that the ScCBLs-ScCIPKs complex may be more responsive to abiotic rather than biotic stimuli. Overall, the results described in the present work will be useful for future investigations and for functional characterization of individual CBLs and CIPKs in Solanum.

Heptahelical protein (HHP) signalling pathway is involved in cold acclimation responses to low temperature and other stresses. The HHP transcription factor family is the key component regulating this signalling pathway. In this study, five HHP-like genes, BcHHP1, BcHHP2, BcHHP3, BcHHP4, and BcHHP5, were isolated from non-heading Chinese cabbage (Brassica rapa ssp. chinensis cv. Suzhouqing). Multiple sequence alignment and phylogenetic analysis showed that BcHHP proteins are highly homologous to HHP proteins from Arabidopsis thaliana, Glycine max, Oryza sativa, and Zea mays. Some of these HHP proteins might share similar functions in some aspects, which might be further proved by interaction network of BcHHP genes. Furthermore, real-time quantitative PCR showed that BcHHP1 was induced under cold and salt treatments. Besides, BcHHP1 was also accumulated in response to abscisic acid and salicylic acid, indicating that BcHHP1 gene might participate in response to hormone treatments. In addition, a BcHHP1-YFP fusion protein was localized to the nucleus and cytoplasm. These results indicated that five BcHHP genes might play important roles in a functional HHP signalling pathway responding to cold treatment. This work might be useful for future functional analysis of other HHP-like genes.

Dendrobium officinale is a traditional Chinese medicinal herb that produces promising bioactive polysaccharides. However, the biosynthetic pathway of polysaccharides in this herb remains to be elucidated. The uridine diphosphate glucose pyrophosphorylase (UGPase) is a key enzyme for the production of uridine diphosphate glucose, which is a major glycosyl donor for synthesis of polysaccharides. This study identified a novel UGPase gene from D. officinale termed as DoUGP. Bioinformatics and subcellular-localization of the DoUGP protein indicate that it belongs to the UGPase-A type and was localized in cytoplasm. The DoUGP was revealed to be constitutively expressed in all organs, and the highest mRNA content was detected in stems, the organs with the highest polysaccharide content. Furthermore, sucrose feeding experiments in D. officinale demonstrate that sucrose addition could increase DoUGP transcription significantly and enhance polysaccharide accumulation accordingly. Together, we conclude that DoUGP probably plays an important role in polysaccharide biosynthesis of D. officinale and is a potential target for quality breeding of this orchid.

The WRKY transcription factors (TFs) are integral parts of signaling pathways that regulate many processes, such as senescence, seed dormancy, seed germination, and resistance to abiotic and biotic stresses. Stress-related functions of WRKY6 have been characterized in Arabidopsis and other plant species, but its role has not been identified in apple. Here, we cloned WRKY6 genes from Malus prunifolia. Two homologues MpWRKY6a and MpWRKY6b found in this species were members of Group II WRKY6 TFs. They were localized to the cell nucleus. MpWRKY6a can bind to W-boxes. Compared with the untransformed wild type plants, MpWRKY6a-overexpressing Arabidopsis plants were more sensitive to methyl jasmonate (MeJA) and less sensitive to methyl viologen and abscisic acid (ABA), which suggests its role in responses to oxidative stress and MeJA or ABA signaling. The results fill a gap in the WRKY6 function in apple and provide basis for resistance improvement of Malus.

Sprouts of potato tubers were excised from the three potato cultivars Agria, Hermes, and Spunta, sterilized and subjected to shoot formation and propagation on Murashige and Skoog (MS) medium supplemented with 1 mg dm^-3 6-benzylaminopurine (BAP) + 0.5 mg dm^-3 gibberellic acid. Shoots were rooted on MS medium supplemented with 1 mg dm^-3 indole-3-butyric acid. To increase shoot vigour prior tuber formation, shoots were subcultured on MS medium supplemented with 0.56 mg dm^-3 BAP, 0.11 mg dm^-3 2,4-dichlorophenoxyacetic acid, and 0.96 mg dm^-3 naphthaleneacetic acid. Under dark, microtuberization on MS media supplemented with 4 mg dm^-3 of both BAP and kinetin was better than 4 mg dm^-3 BAP alone, where they induced higher number of microtubers per shoot and/or the percentage of shoots that formed microtubers. The highest frequency of microtuber formation was achieved when sucrose at high concentration (8 %) was used as carbon source in culture media. Glucose ranked at the second position whereas fructose reduced the microtuber formation frequency when it was used alone or in combination with glucose. Under the applied culture conditions, cvs. Agria and Hermes showed better micropropagation and microtuberization in comparison to cv. Spunta. In addition, isozyme and RAPD techniques revealed that Agria and Hermes are closer to each other when compared with the third cultivar.

Melatonin (MT), a tryptophan derivative, plays an important role in the function and survival of organisms. To better understand the role of MT in cold tolerance, the melon (Cucumis melo L.) were sprayed with various concentrations of MT (0, 50, 100, 200 or 400 μM), exposed to cold stress (day/night temperature of 12/6 °C) for 7 d, and then returned to optimal conditions (28/18 °C) for 7-d recovery. The foliar application of MT (especially 200 μM) significantly alleviated cold-induced growth suppression, and MT-treated plants recovered more quickly than untreated plants. Further, MT-treated plants had higher chlorophyll content, photosynthetic rate, stomatal conductance, as well as maximal quantum yield of photosystem (PS) II photochemistry, and efficiency of excitation energy capture of open PS II centres under cold stress than untreated plants. Furthermore, exogenous MT significantly reduced malondialdehyde content and markedly increased the activities of antioxidant enzymes superoxide dismutase (SOD), guaiacol peroxidase (POD), and catalase (CAT) under cold stress. MT also increased expression of antioxidant genes CmSOD, CmPOD, and CmCAT under cold stress. The results indicate that MT pretreatment alleviated the detrimental effects of cold stress and accelerateds the recovery mainly by enhancing photosynthesis and antioxidant capacity in melon leaves.

About 70 % of the total land area in the world are affected by soil freeze and thaw (FT) cycles. Root is the first organ of plant to sense soil environment and it is unclear how it copes with the soil FT. Based on the different functions of firstorder pioneer and fibrous roots in woody plants, we hypothesize that pioneer and fibrous roots respond differently. The experiment was conducted in a growth chamber using Picea asperata seedlings. We designed the FT based on field observation data. The physiological responses in fibrous and pioneer roots were examined. Fibrous roots had higher root vitality and N content, whereas pioneer roots exhibited higher total nonstructural saccharide content. The accumulation of O₂ ^- under FT treatment was similar in the two types of roots. Pioneer roots showed higher osmolyte (especially proline) content, whereas fibrous roots had higher peroxidase activity. The present study confirmed that fibrous roots have stronger metabolism ability, whereas pioneer roots are the key storage organs. FT in the temperature range from -5 to 5 °C are mild and do not cause serious injury to roots. Pioneer roots have higher tolerance to soil FT in spring than fibrous roots. The roots have different strategies to FT: fibrous roots increase the antioxidant system, whereas pioneer roots accumulate more osmolytes. Such knowledge can help us to understand how roots of woody plants cope with soil FT.

The rice dwarf and narrow leaf mutant 2 (dnl2) is dwarfed and forms narrow and brittle leaves. Its dwarfness was shown to be due to its shortened internodes resulting from a reduced size of the internode parenchyma cells. Its narrow and brittle leaves were attributed to a compromised ability to form vascular bundles but a reduced fiber content and thin cortical layer. However, response to the application of either gibberellin or brassinolide was not different between dnl2 and its wild type. Transcription profiling indicates that a number of cell division/expansion-associated and crude fiber synthesis-related genes were down-regulated in the mutant. A genetic analysis revealed that the mutant phenotype was under monogenic control, and the gene responsible was mapped to a 50.1 kb genomic region on the long arm of chromosome 10. This region was shown to harbor 10 open reading frames. Although transcription profiling these genes indicates that three were differentially transcribed in the mutant, there was no sequence polymorphism in the coding sequence between the mutant and the wild type alleles.

Fructans play vital roles in enhancing plant abiotic stress tolerance by reducing oxidative damage, stabilizing cell membranes, improving the osmotic adjustment capacity, and lowering the freezing point. In this study, a sucrose: fructan-6-fructosyltransferase (6-SFT) gene involved in the synthesis of fructans was isolated from Dasypyrum villosum, Dv-6-SFT, using genomic walking and reverse transcription (RT)-PCR. Alignment of the cDNA sequence with its genomic counterpart showed that no introns were present in the Dv-6-SFT gene, and thus it differs from all other plant 6-SFTs that have been cloned previously. Sequence analysis showed that the cDNA of the Dv-6-SFT sequence comprised 2 175 bp with a 1 863 bp open reading frame, and its deduced protein comprised 620 amino acids with a predicted molecular mass of 68.47 kDa. The Dv-6-SFT gene was transferred into tobacco (Nicotiana tabacum L.) cv. W38 via Agrobacterium-mediated transformation. The screened plants were tested by PCR and semi-quantitative RT-PCR, and the transgenic plants were evaluated under drought, cold, and salt stresses. The Dv-6-SFT transgenic tobacco plants had higher resistance to drought, cold, and salt stress than the non-transgenic plants. Further analysis showed that the transgenic plant expressing Dv-6-SFT had increased content of saccharides and proline, but reduced content of malondialdehyde in leaves. The results of this study demonstrate that the Dv-6-SFT gene is a potential candidate for conferring abiotic stress tolerance in plants and it could be used in crop improvement breeding programs.

The effect of polyamine biosynthesis inhibitors on the salt stress response of rice seedlings was investigated. For this, DL-α-difluoromethylarginine (DFMA) and DL-α-difluoromethylornithine (DFMO), two competitive inhibitors of arginine decarboxylase (ADC) and ornithine decarboxylase (ODC), were used. The ADC and ODC are rate-limiting enzymes involved in synthesis of putrescine. The effective quantum yield of photosynthetic energy conversion (Φ_PSII) decreased with the salt stress, and this decrease was highly significant in the treatments with DFMA and DFMO. Interestingly, addition of exogenous putrescine reduced the decline of Φ_PSII. Putrescine content strongly decreased after one day of the inhibitor treatment. Although the content of spermidine (converted from putrescine) also showed an initial decrease in response to the inhibitors, it recovered to a similar level to that in the control after 3 d of treatment. Under the salt stress, the effect of the inhibitors on the different compounds was similar. Moreover, the addition of exogenous putrescine partially suppressed the decrease in spermidine and spermine content. A positive correlation between the spermidine and spermine content and the Φ_PSII was observed. The results suggest that, under salt stress, a decrease in polyamine biosynthesis and/or polyamine content has a strong negative effect on leaves and increases salt stress sensitivity.

Artemisinin, a natural sesquiterpenoid isolated from Artemisia annua L., is regarded as the most efficient drug against malaria in the world. Artemsinin production in NaCl-treated A. annua seedlings and its relationships with the glucose-6-phosphate dehydrogenase (G6PDH) activity and generation of H₂O₂ and nitric oxide (NO) were investigated. Results revealed that artemisinin content in the seedlings was increased by 79.3 % over the control after 1-month treatment with 68 mM NaCl. The G6PDH activity was enhanced in the presence of NaCl together with stimulated generation of H₂O₂ and NO. Application of 1.0 mM glucosamine (GlcN), an inhibitor of G6PDH, blocked the increase of NADPH oxidase and nitrate reductase (NR) activities, as well as H₂O₂ and NO production in A. annua seedlings under the salt stress. The induced H₂O₂ was found to be involved in the upgrading gene expression of two key enzymes in the later stage of artemisinin biosynthetic pathway: amorphadiene synthase (ADS) and amorpha-4,11-diene monooxygenase (CYP71AV1). The released NO being attributed mainly to the increase of NR activity, negatively interacted with H₂O₂ production and enhanced gene expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR). Inhibition of NO generation partly blocked NaCl-induced artemisinin accumulation, and NO donor strongly rescued the decreased content of artemisinin caused by GlcN. These results suggest that G6PDH could play a critical role in NaCl-induced responses and artemisinin biosynthesis in A. annua.

Brassinolide (BL) alleviates salt injury in cotton seedlings; however, little is known about the molecular mechanisms of this response. In this study, digital gene expression analysis was performed to better understand the regulatory pathways of BL in NaCl-stressed cotton (Gossypium hirsutum L.). Compared with control plants (CK), a total of 1 162 and 7 659 differentially expressed genes (DEGs) were detected in the leaves and roots of NaCl-treated plants, respectively. Most of the DEGs in NaCl-treated plants, compared to CK, were regulated by BL. Moreover, expression patterns of DEGs in BL+NaCl treated plants were similar to those in CK plants; however, the responses of DEGs in the leaves and roots of NaCl-treated plants to BL differed. In the roots, BL-regulated DEGs were involved in protein biosynthesis, whereas in the leaves, BL promoted photosynthesis in NaCl-stressed cotton. BL treatment also significantly increased the overall biomass, chlorophyll a + b content in leaves, and the protein content in roots in NaCl-stressed cotton. The downregulation of stress-responsive genes in BL+NaCl-stressed leaves was also found. These results suggest that BL can alleviate NaCl injury in cotton plants.

The present study aimed to investigate the effects of ethanolamine on glycine betaine and proline metabolism in Nicotiana rustica under salt stress. The in vitro grown tobacco (Nicotiana rustica) plants were pretreated with ethanolamine (at concentrations 70, 130, 270, and 530 μM for biochemical analysis and only at the concentration of 530 μM for molecular analysis) and then transferred to Murashige and Skoog medium containing 200 mM NaCl for 3 weeks. Our results showed that ethanolamine promoted glycine betaine biosynthesis by an increase in betaine aldehyde dehydrogenase (BADH) gene expression and BADH enzymatic activity. Moreover, ethanolamine pretreatment possibly reduced proline content in salt stressed plants via its negative effect on Δ-pyrroline-5-carboxylate synthase (P5CS) gene expression and P5CS enzymatic activity and its positive effect on proline dehydrogenase (PDH) gene expression and PDH activity.

The Arabidopsis heme oxygenase 1 (HY1) plays a significant role in the signal transduction of abiotic stimuli and hormonal response. To characterize the HY1 promoter, an approximately 1.8 kb of it (pHY1, -1666 to +132) and its deletion fragments (5D1, -1528 to +132; 5D2, -1109 to +132; 5D3, -688 to +132; 5D4, -169 to +132; 3D1, -1666 to +100; 3D2, -1666 to -1; and 3D3, -1666 to -170), were fused to the β-glucuronidase (GUS) reporter gene and transformed into Arabidopsis. The transgenic plants were subjected to several environmental stimuli (especially to mild salinity, iron deficiency, and mercury exposure). The results show that the region from +1 to +100 in the 5'-untranslated region were essential for HY1 basal promoter activity. The induced GUS activities under NaCl and H₂O₂ treatments were slowed down by the progressive 5' deletion (from -1666 to -688) and correlated with the reduced numbers of myeloblastosis (MYB) binding sites (MBSs; -1542, -1333, -1078, and -177). The MBS-free promoter construct 5D4 (-169 to +132), however, fully lost the inducibility. Therefore, we propose that the MBS elements existing in the HY1 promoter might be crucial for salinity-induced HY1 up-regulation in an H₂O₂-dependent fashion. Moreover, the regions from -169 to -1 and -688 to -169 were presumed as the regulatory regions of HY1 promoter in response to iron deficiency and mercury exposure, respectively.

Histone modification is a ubiquitous regulator of gene transcription. Arabidopsis CUP-SHAPED COTYLEDON (CUC) genes serve as a marker for shoot apical meristem initiation, but how they are regulated during shoot regeneration from in vitro culture, it is not yet understood. Here, the histone modification status of CUC1, CUC2, and CUC3 was analysed using a combination of chromatin immunoprecipitation (ChIP) and real time quantitative PCR. The activation of CUC1 and CUC2 was associated with an increased level of histone H3K4 trimethylation and/or H3K9 acetylation, as well as a reduced level of H3K9 demethylation in various parts of their promoter and coding sequences. Histone modification is suggested to play an important role in regulating CUC1 and CUC2 expression during shoot regeneration.

The speciation allele at Eml-A1 of hexaploid wheat, which causes embryo lethality in wheat-rye hybrids, was investigated using cytologically modified genetic stocks. It was demonstrated that an extra dose of this allele had no effect on embryo development in these hybrids. There was no positive effect on embryo development and, therefore, no overcoming of the postzygotic barrier. An abortion of the hybrid embryos at an earlier stage of development was also not observed. Physical mapping was performed using chromosome 6A deletion lines. This study revealed the location of Eml-A1 on the most distal part of the long arm of chromosome 6A. To identify possible candidate genes responsible for embryo lethality, in silico sequence homology analysis was performed. Two candidate genes for Eml-A1 that are involved in shoot apical meristem maintenance were identified on chromosome 6AL. However, functional validation assays need to be designed and performed.

Ran is involved in response to external stimuli. In this study, six MsRan gene cDNA sequences were isolated from wild banana (Musa spp. AB group) from Sanming City, China. Sequence analysis reveals that MsRan3A, MsRan3A-1a, and MsRan3C contained Ran protein domains including a GTP hydrolysis domain, a RanGAP-binding domain, and an acidic tail, whereas two G boxes (G4 and G5) were absent in MsRan3A-6a. The physicochemical property of MsRan3A, MsRan3A-1a, MsRan3A-6a, and MsRan3C appeared to differ significantly. Real time quantitative PCR (qPCR) analysis indicates that MsRan3A-1, MsRan3A-5, MsRan3A-6, MsRan3A-6a, and MsRan3C-1 were expressed in roots, leaves, peduncles, bracts, flowers, peels, and pulp of the wild banana. MsRan3A-1a was expressed at extremely low levels in these tissues and was undetectable by qPCR. The MsRan genes were found to be involved in responses to a low temperature stress but with different response patterns. Furthermore, salicylic acid significantly enhanced MsRan gene expressions suggesting the involvement of these genes in salicylic acid signal transduction.