Fulltext search in archive
Results 31 to 60 of 660:
Establishment of callus and cell suspension cultures of Centella asiaticaS. Nath, A. K. BuragohainBiologia plantarum 49:411-413, 2005 | DOI: 10.1007/s10535-005-0017-6 Methods for induction of callus and cell suspension cultures have been developed for the medicinally important herb Centella asiatica (L.) Urban. Thin layer chromatography (TLC) and high performance liquid chromatography (HPLC) analysis showed the presence of asiaticoside in the in vitro grown leaves, callus and cell suspension cultured cells. |
An efficient in vitro method for mass propagation of Tylophora indicaM. Faisal, M. AnisBiologia plantarum 49:257-260, 2005 | DOI: 10.1007/s10535-005-7260-8 A protocol of high frequency shoot organogenesis and plant establishment from stem derived callus has been developed for Tylophora indica (Burm. f.) Merrill. - an endangered medicinal plant. Callus was developed on Murashige and Skoog (MS) medium supplemented with 10 μM 2,4,5-trichlorophenoxy acetic acid (2,4,5-T). Multiple shoot induction was achieved from the surface of the callus after transferring onto shoot induction medium. The highest rate (80 %) of shoot multiplication was achieved on MS medium containing 5.0 μM kinetin. The developed shoots rooted best on half-strength MS medium supplemented with 0.5 μM indole-3-butyric acid (IBA). The in vitro raised plantlets with well developed shoot and roots were acclimatized successfully and grown in greenhouse. |
Transcriptomic and proteomic profile approaches toward drought and salinity stressesK. JAMSHIDI GOHARRIZI, S. KARAMI, M.R. HAMBLIN, M.M. MOMENI, T. BASAKI, M. MOSTAFAEI DEHNAVI, M. NAZARIBiologia plantarum 66:255-271, 2022 | DOI: 10.32615/bp.2022.035 Drought and salinity, which can alter the water balance, disrupt the ionic equilibrium, and create reactive oxygen species (ROS), are capable of destroying plant tissues. In this study, transcriptomics, proteomics, and metabolomics have been used to elucidate various abiotic stress responses. In transcriptional signaling pathways, abscisic acid (ABA) is one of the plant phytohormones that regulate the stress response. On the other hand, several regulons and factors of transcription contributed in the reaction to osmotic stresses, as well as in ABA-dependent/independent signaling pathways. However, the findings display that intricate molecular reaction of plants under stress conditions may be controlled by complicated regulative networks of gene expression and signal transduction, as well as by the interaction between them. From the point of view of proteomics, protein modifications in response to stress can be considered as a molecular tool to improve the resistance of plants to environmental stresses. These studies have provided new information about the significance of several gene and protein networks involved in the response of plants to salinity and drought, and the induction of tolerance. Moreover, identifying the crucial pathways which are involved in salinity and drought resistance can open doors for the establishment of commercial-resistant crop cultivars, and might be very useful in the next-generation crop breeding strategies to produce plants with salinity and drought-resistant traits. |
Improved shoot regeneration system through leaf derived callus and nodule culture of Sansevieria cylindricaA. Shahzad, N. Ahmad, M. A. Rather, M. K. Husain, M. AnisBiologia plantarum 53:745-749, 2009 | DOI: 10.1007/s10535-009-0136-6 Long-term culture establishment and efficient in vitro regeneration protocol for Sansevieria cylindrica Bojer ex Hook was developed using leaf derived callus and nodule culture. Profuse callus induction on leaf discs was achieved on Murashige and Skoog (MS) medium supplemented with 10 µM indole-3-butyric acid (IBA), while a high frequency of nodulation was induced on 2,4-dichlorophenoxyacetic acid (2,4-D) and 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) containing media. Shoot regeneration ability from cultured tissues occurred at varying degrees on all media. Through callus culture a maximum of 17.6 ± 0.14 shoots per culture was formed on medium containing 5µM 6-benzyladenine (BA) and 2 µM α-naphthaleneacetic acid (NAA). Among nodule cultures, the 2,4-D generated nodules were more proliferative and regenerative as compared to 2,4,5-T induced nodules and a maximum of 25 ± 0.16 shoots per culture was produced on a medium containing 5 µM BA plus 1 µM NAA. The regenerated shoots were successfully rooted on a semi-solid half strength MS medium containing 5 µM IBA with an average root number 3.5 ± 0.18 and root length 6.5 ± 0.14 cm. The regenerative ability of callus tissues was steady upto one year, while the nodules retained the totipotency to regenerate on optimal medium even after 3 years of subculturing. The histological sections of nodules confirm the typical anatomy exhibiting the vascular elements in bundles with well demarcated cortex and epidermal covering. |
Detection of DNA methylation pattern in thidiazuron-induced blueberry callus using methylation-sensitive amplification polymorphismA. Ghosh, A. U. Igamberdiev, S. C. DebnathBiologia plantarum 61:511-519, 2017 | DOI: 10.1007/s10535-016-0678-3 During the normal developmental process, programmed gene expression is an essential phenomenon in all organisms. In eukaryotes, DNA methylation plays an important role in the regulation of gene expression. The extent of cytosine methylation polymorphism was evaluated in leaf tissues collected from the greenhouse grown plants and in in vitro-derived callus of three lowbush and one hybrid blueberry genotypes, using methylation-sensitive amplification polymorphism (MSAP) technique. Callus formation started from the leaf segments after 4 weeks of culture on a thidiazuron (TDZ) containing medium. Maximum callus formation (98 %) was observed in the hybrid blueberry at 1.0 mg dm-3 TDZ. Although noticeable changes in cytosine methylation pattern were detected within the MSAP profiles of both leaf and callus tissues, methylation events were more polymorphic in calli than in leaf tissues. The number of methylated CCGG sites varied significantly within the genotypes ranging from 75 to 100 in leaf tissues and from 215 to 258 in callus tissues. Differences in the methylation pattern were observed not only in a tissue-specific manner but also within the genotype in a treatment specific manner. These results demonstrated the unique effect of TDZ and the tissue culture process on DNA methylation during callus development. |
Differential expression of VRN1 and other MADS-box genes in Festuca pratensis selections with different vernalization requirementsÅ. Ergon, H. Hamland, O. A. RognliBiologia plantarum 57:245-254, 2013 | DOI: 10.1007/s10535-012-0283-z Most perennial and winter annual temperate grasses have a vernalization requirement (VR) for flowering, that is, they require a cold period before they can flower in response to long days. From a F1 mapping population of the outbreeding perennial forage grass Festuca pratensis Huds. (meadow fescue) previously used to map several quantitative trait loci (QTLs) for VR, we produced two F2 populations divergently selected for high or low VR. The two populations were characterised for flowering behaviour and gene expression of VRN1 as well as other MADS-box genes with a putative function in the induction of flowering. Expression of FpVRN1 and the VRN1-like genes FpMADS2 and FpMADS3 was associated with flowering but the response of gene expression to vernalization differed between genes and populations. The expression of the SVP-like genes FpMADS10 and FpMADS16 was not affected by vernalization and did not differ between the two F2 populations. |
Regeneration Capacity of Calli Derived from Immature Embryos in Spring Barley CultivarsE. Halámková, J. Vagera, L. OhnoutkováBiologia plantarum 48:313-316, 2004 | DOI: 10.1023/B:BIOP.0000033464.36078.24 Callogenesis, somatic embryogenesis and regeneration capacity in twenty-three agronomically important spring barley (Hordeum vulgare L.) cultivars on induction media with 2,4-dichlorophenoxyacetic acid (2,4-D) or 3,6-dichloro-o-anisic acid (dicamba) and on modified regeneration media were studied. The frequency of zygotic embryos exhibiting callogenesis varied from 88 to 100 % according to genotype. Dicamba was more suitable for somatic embryogenesis induction and exhibited a higher frequency of regenerants than did 2,4-D. Green regenerants were obtained in all cultivars, and there were no albino plants. Except for cv. Victor all cultivars used in the experiment showed lower regeneration capacity as compared to the model cv. Golden Promise. |
In vitro regeneration of Aristolochia tagala and production of artificial seedsM. Remya, V. Narmatha Bai, V. N. MutharaianBiologia plantarum 57:210-218, 2013 | DOI: 10.1007/s10535-012-0280-2 Protocols for in vitro plant multiplication from somatic tissues and production of artificial seeds through encapsulation of nodes were developed for Aristolochia tagala Cham., a rare and valuable medicinal plant, as a measure of conservation and as a prerequisite for genetic transformation procedure. A maximum number of adventitious shoots were regenerated from leaf-derived callus on Murashige and Skoog (MS) medium containing 6-benzylaminopurine (BAP; 2 μM), α-naphthaleneacetic acid (NAA; 0.5 μM), and phloroglucinol (PG; 10μM). Nodes collected from in vitro established shoot cultures were encapsulated in 3 % (m/v) sodium alginate and 1 % (m/v) calcium chloride. Multiple shoots were successfully regenerated from the encapsulated nodes cultured on MS medium supplemented with 3 μM BAP and 0.5 μM kinetin (KIN). Regenerated shoots from callus and artificial seeds were successfully rooted and acclimated to greenhouse conditions. Since roots of A. tagala are primarily used in traditional medicine, a protocol for regenerating roots directly from the leaf derived callus was also developed. Maximum root length was obtained when the callus was cultured in MS medium supplemented with KIN (1 μM), indole acetic acid (IAA; 0.5 μM), NAA (0.1 μM), and PG (10 μM). Biochemical parameters were studied in calli grown with and without PG in the medium to establish a correlation between these parameters and shoot morphogenesis. An increment of antioxidant enzymes (peroxidase and catalase) and metabolites (sugars and proteins), and a decrease in the amount of polyphenol oxidase was observed in the calli which were grown in the presence of PG. |
Simultaneous induction of anthocyanin and peroxidase by sucrose in hypocotyls and roots of Chinese red radish seedlingsL. WANG, X.-X. JING, P.-P. ZHAO, L.-F. WANG, Y. YIN, Y.-F. LIBiologia plantarum 64:828-837, 2020 | DOI: 10.32615/bp.2020.156 Anthocyanin and peroxidase (POD) are important active compounds in Chinese red radish (Raphanus sativus L.). The effects of exogenous sucrose, mixture of fructose and glucose (F/G 1:1), and mannose on anthocyanin accumulation and POD activity were investigated in hypocotyls and roots of red radish seedlings. Sucrose was most effective in inducing anthocyanin accumulation and POD activity in both organs, followed by F/G; mannose caused only a little increase of anthocyanin content and POD activity in hypocotyls, but a decrease in roots. The distribution of anthocyanin accumulation was different between hypocotyls and roots in the presence or absence of sucrose. Anthocyanin was clearly induced in root tips and cortex under exogenous sucrose. Accumulation of anthocyanin was closely correlated to the increase of endogenous sucrose content rather than glucose or fructose content. Sucrose significantly induced the expressions of late anthocyanin biosynthetic genes by up-regulating Raphanus sativus myeloblastosis 1 and Raphanus sativus transparent testa 8 in both organs. The POD activity significantly increased following the remarkable accumulation of anthocyanin in hypocotyls under exogenous sucrose, which may be partially required for anthocyanin oxidation. In roots, the high POD activity might lead to a low anthocyanin content by degrading anthocyanin and diverting the metabolic flux to lignin synthesis. |
Somatic embryogenesis and regeneration of Cenchrus ciliaris genotypes from immature inflorescence explantsC. B. Yadav, P. Jha, C. Mahalakshmi, V. Anjaiah, V. BhatBiologia plantarum 53:603-609, 2009 | DOI: 10.1007/s10535-009-0111-2 An efficient, highly reproducible system for plant regeneration via somatic embryogenesis was developed for Cenchrus ciliaris genotypes IG-3108 and IG-74. Explants such as seeds, shoot tip segments and immature inflorescences were cultured on Murashige and Skoog (MS) medium supplemented with 2.0-5.0 mg dm-3 2,4-dichlorophenoxyacetic acid (2,4-D) and 0.5 mg dm-3 N6-benzyladenine (BA) for induction of callus. Callus could be successfully induced from all the three explants of both the genotypes. But the high frequency of embryogenic callus could be induced only from immature inflorescence explants. Somatic embryos were formed from nodular, hard and compact embryogenic calli when 2,4-D concentration was gradually reduced and BA concentration increased. Histological studies of somatic embryos indicated the presence of shoot apical meristem with leaf primordia. Ultrastructural details of globular and scutellar somatic embryos further validated successful induction and progression of somatic embryogenesis. Shoots were differentiated upon germination of somatic embryos on MS medium containing 2,4-D (0.25 mg dm-3) and BA or kinetin (1-5 mg dm-3). Roots were induced on 1/2 MS medium containing charcoal (0.8 %), and the regenerated plants transferred to pots and established in the soil showed normal growth and fertility. |
Effect of abscisic acid and proline on in vitro flowering in Vigna aconitifoliaS. N. Saxena, N. Kaushik, R. SharmaBiologia plantarum 52:181-183, 2008 | DOI: 10.1007/s10535-008-0040-5 An experiment was taken up to find out possibilities of manipulating the in vitro flowering in moth bean. Abscisic acid (ABA) and proline both alone and in combination influenced days to flower induction, number of flowers per plant, number of pods per plant and seeds per pod. Frequency of flowering plants approached 100 % at 1 and 3 µM ABA and 800 µM proline. The range of flowering period (3 to 23.6 d) has also been influenced by various treatments. |
In vitro organogenesis and plant regeneration from unpollinated ovary cultures of Azadirachta indicaP. Srivastava, M. Singh, P. Mathur, R. ChaturvediBiologia plantarum 53:360-364, 2009 | DOI: 10.1007/s10535-009-0067-2 A novel method of organogenesis in neem (Azadirachta indica A. Juss.) from unfertilized ovaries is described. The Murashige and Skoog's (MS) medium with 9 % sucrose, 1 µM 2,4-dichlorophenoxyacetic acid (2,4-D) and 5 µM 6-benzylaminopurine (BAP) was the best for callus induction from unfertilized ovaries. However, further proliferation of callus occurred better on MS medium supplemented with 0.5 µM 2,4-D either alone or in combination with 4.5 µM kinetin. Maximum shoot regeneration (78 %) was observed when calli, induced from ovaries of 4 mm size flower buds and proliferating on MS + 0.5 µM 2,4-D, were subcultured to MS medium containing 5 µM BAP. Histological analysis revealed that 4 mm sized flower bud corresponds to a 2-nucleate stage of embryo sac. The shoots were then multiplied by forced axillary branching on MS medium supplemented with 1.0 µM BAP and 250 mg dm-3 casein hydrolysate. The shoots could be rooted on 1/4 strength MS medium supplemented with 0.5 µM indole-3-butyric acid (IBA) at a frequency of 79 %. Cytological analysis by root tip squash preparations revealed that all the plantlets were diploids. These plants were subsequently hardened and established in soil with transplantation rate of 81.8 %. |
Lysigenous aerenchyma formation: responsiveness to waterlogging in oil palm rootsS. NUANLAONG, S. WUTHISUTHIMATHAVEE, P. SURANINPONGBiologia plantarum 65:167-176, 2021 | DOI: 10.32615/bp.2021.002 Oil palm (Elaeis guineensis Jacq.) responds to waterlogging stress by induction of lysigenous aerenchyma tissues, which facilitates the flow of oxygen through their root tissues for survival under waterlogged conditions. Thus, the morphological and genetic adaptation involved in lysigenous aerenchyma formation in the roots of the oil palm genotype Deli × Calabar under waterlogging stress was evaluated. This study found the highest number of dead cells after waterlogging stress for 2 d in the secondary root, while the percentage of root porosity was increased with increasing of time in both roots, especially at 1.0 - 2.0 cm from the root tip. This change in cell morphology implied the formation of lysigenous aerenchyma in oil palm roots under waterlogging stress. At the same time, most of the candidate genes involved in lysigenous aerenchyma formation revealed a higher mRNA expression after waterlogging stress for 3 d. Genes of ethylene synthesis group ACS3, ACO, and ACO1 were highly up-regulated in both types of roots, while XTH22, XTH23, and CEL12 in the cell wall modification group were more highly up-regulated in the primary roots than in the secondary roots. CML11, CAMTA4, TCTP, and CPI1 in a signaling group were up-regulated in the primary roots, but they were down-regulated in the secondary roots. NAC29, ERF1, ERF113, and HSFA2C in a transcription factor group were strongly up-regulated in the oil palm roots. However, there have been no previous reports on the expression of CAMTA4, bHLH79, and bHLH94 under waterlogging conditions. Our findings confirm gene expression during lysigenous aerenchyma development in oil palm roots under waterlogging. It can also be stated that primary roots are an important part of the adaptation mechanism of oil palm roots for survival under waterlogging stress. Furthermore, the molecular markers of all expressed genes will be developed and applied in our oil palm breeding project for selection of waterlogging tolerance. |
Physiological and biochemical changes during graft union formation in Carya illinoinensisW.C. SU, H.Y. HE, Z.Z. LIU, Z.H. MO, F. CAO, F.R. PENGBiologia plantarum 65:203-211, 2021 | DOI: 10.32615/bp.2021.023 To reveal the physiological and biochemical mechanism underlying graft union formation in pecan (Carya illinoinensis), dynamic changes in content of nutrients, tannin, and phytohormones together with key enzyme activities were investigated 0, 3, 5, 7, 10, 14, 18, 22, 31, and 40 d after grafting (DAG), in homograft unions. During graft union formation, peroxidase (POD) activity increased at 7 - 10 DAG compared with that at 0 DAG. Polyphenol oxidase (PPO) activity was higher in grafted than ungrafted pecan seedlings (control) at 22 DAG, which was similar to POD activity. The tannin content exhibited a decreasing trend with grafting relative to the control. Indole-3-acetic acid (IAA) and zeatin riboside (ZR) content increased from 7 - 10 DAG, with higher average content than in the control at 14 - 31 DAG. Abscisic acid (ABA), soluble sugar, starch, and soluble protein content was generally lower in grafted plants than in the control. Combined with our previous anatomical observations, these results suggested that, during graft development, some enzymes and growth promoting hormones might be required for callus proliferation at early stage and for vascular reconnection at the later stage. Nutrients provided energy for the whole graft development process. In contrast, some polyphenols and growth inhibiting hormones seemed to have negative effects on this process. |
Methyl jasmonate elicitation of common bean seedlings induces nucleotidase activity and the expression of several nucleotidase genes in radiclesG. GALVEZ-VALDIVIESO, M. GARMENDIA-CALVO, M. PINEDA, P. PIEDRASBiologia plantarum 65:246-254, 2021 | DOI: 10.32615/bp.2021.017 Nucleotides are the basic elements of the genetic material, participate in bio-energetic processes, are cofactors and components of secondary metabolites, etc. Nucleotide hydrolases (nucleotidases) are phosphatases that remove the 5'-phosphate group from the nucleotides and play a crucial role in nucleotide metabolism. In this study, genes encoding putative nucleotidases in Phaseolus vulgaris have been identified, and the effect of methyl jasmonate (MeJA) on both nucleotidase activity and gene expression has been addressed. The predicted nucleotidase peptides include the conserved domains characteristic of the haloacid dehalogenase-like hydrolase superfamily. The analysis of the expression of the 11 identified genes in radicles of common bean seedlings elicited with MeJA showed that 3 of them are highly induced by this phytohormone in a dose-dependent manner. Nucleotidase activity in radicles from MeJA treated plants was higher than in not elicited seedlings, and this induction was observed with all the nucleotides assayed (mono-, di- or triphosphate) and with purine or pyrimidine nucleotides. MeJA is involved in biotic and abiotic stress, and the induction of nucleotide metabolism in response to this treatment suggests a relevant role for nucleotides in the seedlings response to unfavourable conditions. |
Successful micropropagation protocol of Piper methysticumZ. Zhang, L. Zhao, X. Chen, X. ZhengBiologia plantarum 52:110-112, 2008 | DOI: 10.1007/s10535-008-0020-9 An efficient in vitro propagation of kava (Piper methysticum) was established. Utilizing 15-d-old tender shoots from dormant auxiliary buds as explants, significant induction of vigorous aseptic cluster shoots was achieved in Murashige and Skoog (MS) medium containing 0.5 mg dm-3 6-benzyladenine (BA), 0.5 mg dm-3 indole-3-acetic acid (IAA), and antibiotics after 30 d. In vitro rooting was achieved at 100 % efficiency in MS medium containing 0.75 to 1.00 mg dm-3 IAA or indole-3-butyric acid and 3 % sucrose. The most robust and long roots were observed in medium with IBA. Moreover, the embryonic callus was induced from petioles in MS medium supplemented with 1.0 mg dm-3 BA and 0.1 mg dm-3 IAA, of which 70 % differentiated into shoots in the presence of 1.0 mg dm-3 BA and 0.5 mg dm-3 IAA. |
Factors affecting plant regeneration from immature inflorescence of two winter wheat cultivarsM. Kavas, H. A. Öktem, M. YücelBiologia plantarum 52:621-626, 2008 | DOI: 10.1007/s10535-008-0122-4 Inflorescence explants of two winter wheat cultivars, Triticum durum cv. Kiziltan-91 and T. aestivum cv. Bezostaja-01, were used to evaluate the effects of vernalization period of donor plants, callus age and medium composition on regeneration capacity. Donor plants were grown for 7 d and they were exposed to 4 °C for 1, 2, 3, 4, and 5 weeks. The maximum inflorescence formation was observed as 79 % at 4 weeks and 73 % at 5 weeks of vernalization period for Kiziltan-91 and Bezostaja-01, respectively. Among 6 different callus induction and regeneration mediums, I1-R1 and I3-R3 have to be the best responding mediums for Kiziltan-91 and Bezostaja-01, respectively. In Kiziltan-91, calli induced from donor plants, vernalized for 3 weeks, showed a significantly lower regeneration capacity than counterparts vernalized for 4 and 5 weeks. The highest regeneration capacity of 69 % was obtained from 6-week-old calli produced from 4 weeks vernalized Kiziltan-91 donor plants. In contrast to Kiziltan-91 cultures, the effects of vernalization period and callus age on regeneration capacity were not significant in Bezostaja-01 cultures. The maximum numbers of tillers were obtained from 6-and 15-week-old calli for Bezostaja-01 and Kiziltan-91, respectively. In contrast to vernalization period of donor plants, callus age had no effect on seed number. |
The toxicity of BDE-47 to the photosystem of Lemna minor frondsN.W. QIU, W.R. ZHANG, X.H. YAN, R.J. WANG, L. TIAN, G.L. HAN, F. ZHOUBiologia plantarum 64:591-597, 2020 | DOI: 10.32615/bp.2020.091 To elucidate the toxicity of 2,2ʹ,4,4ʹ-tetrabromodiphenyl ether (BDE-47) on photosynthetic primary processes, in vivo and in vitro treatments of BDE-47 were performed. The 20-d treatment in vivo (5 - 20 μg dm-3) suppressed the reproduction of duckweed (Lemna minor) and led to decline in chlorophyll (Chl) content of fronds. The most obvious features of BDE-47-treated fronds included a Chl a fluorescence rise at the J phase and a depression at the G phase, whereas significant fluorescence rises at the L, K, and J phases were found on the ΔVt curve of thylakoid membranes treated with 10 - 15 mg dm-3 BDE-47 for 4 h (in vitro). In both in vivo and in vitro experiments, the BDE-47 treatments significantly reduced the density of the active reaction centers (RC/CSo), affected the efficiency and speed of photosynthetic electron transfer [the maximum quantum yield of photosystem (PS) II photochemistry - Fv/Fm, quantum yield for electron transport (at t = 0) - φEo, electron transport flux per excited cross section - ETo/CSo, and net rate of reaction centers closure at 300 and 100 μs - dV/dto and dVG/dto, respectively], and increased energy dissipation [quantum yield for energy dissipation (at t = 0) - φDo, dissipated energy flux per reaction center - DIo/RC, and issipated energy flux per excited cross section - DIo/CSo]. The BDE-47 at 5 - 15 mg dm-3 had no impact on the minimum (initial) fluorescence (Fo) and total electron carriers per reaction center (Sm) of the thylakoid membranes, but PS II units were less tightly grouped (a positive L-band). On the contrary, there was no positive L-band on the difference between relative fluorescence intensities of the normalized induction curves from 50 μs to 300 μs (WK) of each BDE-47 treatment and control (ΔWK), and Fo and Sm increased after the treatment with BDE-47. The above results indicate that BDE-47 not only affected the permeability of thylakoid membranes, but also relaxed the structure of PS II, thereby affecting the function of PS II. In addition, BDE-47 could induce secondary damage to the PSs in duckweed fronds. |
Structural and chemical study of callus formation from leaves of Rubia tinctorumN. Orbán, I. Boldizsár, K. BókaBiologia plantarum 51:421-429, 2007 | DOI: 10.1007/s10535-007-0091-z Dedifferentiation was monitored in Rubia tinctorum L. leaves over a 14-d period after callus induction using transmission electron microscope (TEM), high performance liquid chromatography (HPLC), spectroscopy and thin layer chromatography (TLC). Photosynthetic pigment loss of leaves took 3-5 d coinciding with the first period of anthraquinone accumulation. Callus cells were discernible in the region of the vascular bundles and wounded edges of leaves after 10-14 d. Characteristic ultrastructural alterations were manifested in vacuolization, appearance of mitochondria, amount of smooth endoplasmatic reticulum and cytoplasm, caryolympha density of nuclei and cytoplasm content of cells. There were special events in the transfer cells: unequal divisions of dedifferentiated plastids and lytic activity in the cell wall. Our results show that mesophyll cells seem to be stopped at a particular level of dedifferentiation, while transfer cells embodied in veins of leaves pass through further alterations and lead to callus formation. Findings suggest that a sort of dedifferentiation drift manifests in the various cells of R. tinctorum leaves during callus induction and depending on their specialized status they achieve different levels of dedifferentiation. Approximately 4 weeks after callus induction, root growth has started from the young calli. |
Effect of virus inducible cis-element insertion on transcription properties of improved GWSF promoter in Arabidopsis thalianaZ.C. HUANG, H. LIBiologia plantarum 64:320-323, 2020 | DOI: 10.32615/bp.2020.032 An ideal synthetic promoter can accurately regulate gene expression and the minimal cauliflower mosaic virus 35S promoter (GWSF) is an ideal synthetic pathogen-inducible promoter (SPIP) with several advantages. Three modified SPIPs, named as VGWSF, GWVSF, and GWSFV according to the arrangement of cis-elements, were optimized by inserting the dimer of a virus inducible cis-element (TTGGGAAGGAATTTCCTACT, V-box) upstream, midstream, or downstream the GWSF sequence. The three promoters were used to replace the cauliflower mosaic virus 35S promoter in the plasmid pBI121 in order to control the expression of the β-glucuronidase (gus) gene. Transformation of Arabidopsis thaliana (ecotype Col‑0) plants was performed via the Agrobacterium tumefaciens strain GV3101 by the floral dip method. The five-week-old transgenic T3 lines were histochemically stained for GUS activity to evaluate the transcriptional properties of modified SPIPs. The VGWSF and GWVSF had low basal expressions and could not be induced by low or high temperatures and a low osmotic potential but could be induced by the tobacco mosaic virus (TMV). Although GWSFV had the highest GUS activity, it showed a substantial basal expression. After being treated with TMV, abscisic acid (ABA), salicylic acid (SA), or ethylene (Eth) for12 h, the expressions of modified SPIPs were evaluated by real-time quantitative PCR. With the basal expression of GWSF as a reference, each treatment was represented as log2 (fold to the GWSF basal level). The basal expression of VGWSF and expressions induced by TMV, ABA, SA, and Eth were 1.39, 3.42, 6.01, 4.14, and 2.26, respectively, whereas the corresponding values of GWVSF were 1.16, 4.07, 3.72, 4.65, and 3.98, respectively, and the corresponding values of GWSFV were 4.43, 6.11, 4.83, 3.69, and 3.34, respectively. The results revealed that three modified SPIPs acquired virus induction activity due to the insertion of V-box. The V-box insertion position had a significant impact on transcription properties of modified SPIPs. |
Identification and expression pattern analysis of YUCCA and ARF gene families during somatic embryogenesis of Lilium spp.M.-M. CHEN, X. LI, Y.-M. CAI, Y.-C. ZHANG, J.-J. GU, L.-Y. YANGBiologia plantarum 64:385-394, 2020 | DOI: 10.32615/bp.2020.026 Auxin is a key phytohormone in plant somatic embryogenesis (SE) and YUCCA and AUXIN RESPONSE FACTORS (ARFs) are two key genes involved in auxin biosynthesis and auxin signaling pathways, respectively. They have been reported in participating to the catalytic production of endogenous indole-3-acetic acid (IAA; a natural auxin) and regulating the transcription of auxin-responsive genes. To explore the structural characteristics of the YUCCA and ARF families of Lilium spp. L. and its expression pattern during SE induction and development processes, 6 YUCCA genes and 12 ARF genes were screened from the transcriptome database, and their nucleotides and encoded proteins were analyzed. At the same time, the expression patterns of YUCCA and ARF genes were analyzed by reverse transcription quantitative PCR, and endogenous IAA content was measured. Results show that the members of Lilium indole-3-pyruvate monooxygenase YUCCA (LiYUCs) are structurally conserved among Lilium spp., Oryza sativa, and Arabidopsis thaliana. The LiARFs are classified into six groups, most LiARFs have a closer affinity to the monocotyledon Oryza sativa. All the 12 LiARFs are involved in the SE induction and development, but their expression patterns differed. The LiYUC2/4 and LiARF5/7/21 had expression profiles corresponding with IAA content during the SE induction periods. The LiYUC4/10 and LiARF7/17/18/20/21/22 showed a similar downward trend with IAA content during the progress of the SE development. The results provide a basis for further research on the functions of YUCCA and ARF genes during somatic embryogenesis of Lilium spp. |
The enhancement of salt stress tolerance by salicylic acid pretreatment in Arabidopsis thalianaL.-L. YU, Y. LIU, F. ZHU, X.-X. GENG, Y. YANG, Z.-Q. HE, F. XUBiologia plantarum 64:150-158, 2020 | DOI: 10.32615/bp.2019.151 Salicylic acid (SA) is an important plant hormone involved in the activation of defense responses against environmental stresses. However, there are still large of unsolved mysteries about how SA pretreatment affects the establishment of plant stress tolerance. In this study, application of SA at different concentrations and different times were conducted to investigate their effects on the response of Arabidopsis seedlings to salt stress. The pretreatment with 10 or 20 μM SA for more than 6 h promoted Arabidopsis seedlings resistance to salt stress. On the other hand, pretreatment with 200 μM SA reduced Arabidopsis resistance to salt stress and aggravated oxidative damage to the seedlings. At all concentrations used, SA pretreatment inhibited the total respiration and promoted reactive oxygen species (ROS) generation. However, the ROS content in 10 or 20 μM SA pretreated seedlings decreased to the basal level within 6 h and high activities of antioxidant enzymes and alternative oxidase were maintained. Notably, the SA-enhanced salt stress resistance was significantly impaired by blocking alternative oxidase (AOX) pathway. Our findings indicate that SA-mediated salt stress response is in a dose- and time-dependent manner and that the effects were related to the induction of AOX capacity and antioxidant system. |
Callus induction in culture of Oenothera hookeri and Oenothera picensis anthersL.D. Martínez, I. Noher De HalacBiologia plantarum 39:11-16, 1997 | DOI: 10.1023/A:1000980031227 In the present work we try to determine optimum conditions for callus induction in anther culture of Oenothera hookeri and O. picensis. The anther callus yield was increased when the anthers were cultured on modified MS medium supplied with 2 mg dm-3 2,4-D and 2 mg dm-3 NAA, in both species. In O. hookeri, best results were obtained when anthers were excised from 7.2 - 9 mm buds at the stage of vacuolated microspores, then pretreated at 4 °C for 2 d and grown under 16-h photoperiod. The response to anther culture of O. picensis was generally very poor compared with that of O. hookeri. The higher yield of calli was obtained when anthers were excised from 6.2 - 8 mm buds at the stage of vacuolated microspores and grown under continuous light. The cold pretreatment of buds decreased anther response in this species. |
Histological and biochemical parameters of Crocus sativus during in vitro root and shoot organogenesisE. Vatankhah, V. Niknam, H. EbrahimzadehBiologia plantarum 58:201-208, 2014 | DOI: 10.1007/s10535-013-0388-z Content of malondialdehyde (MDA), proline, phenolics, and saccharides was analyzed during different developmental stages of in vitro root and shoot organogenesis in saffron. The highest content of MDA, proline, and phenolics was detected in nodular calli. Significant changes were also found in the content of polysaccharides, soluble saccharides, oligosaccharides, and reducing saccharides during developmental stages. Histological investigation of nodular calli showed meristematic zones with small and densely stained cells situated at peripheral zones of calli. The meristematic zones surrounded some vascular areas from which de novo organs originated. The parenchymatic cells of inner zones of calli converted to procambium cells that produced vascular tissues. |
Morphogenetic routes of long-term embryogenic callus culture of Areca catechuH. C. Wang, J. T. Chen, W. C. ChangBiologia plantarum 54:1-5, 2010 | DOI: 10.1007/s10535-010-0001-7 Early morphogenetic events and repetitive embryogenesis from callus culture of betel nut palm (Areca catechu L.) were studied using scanning electron microscopy. On Murashige and Skoog (MS) medium supplemented with 2 mg dm-3 dicamba, callus culture has capacity to form plantlets via somatic embryogenesis and to form secondary embryos for about 4 years. However, various abnormal embryos without differentiation of the leaf sheath and shoot apical meristem were observed, which showed bell-shaped and then cup-shaped or mushroom-shaped structures. These abnormal embryos contained distinctive structures, including a disk-shape interior region, surfaces with grooves and a stalk-like posterior region. During subculture, these abnormal embryos enlarged, became deformed and gradually lose their shape and then converted into nodular, compact embryogenic callus. It was also found that secondary embryos originated from interior surfaces or posterior regions of abnormal embryos, and gave rise to the next cycle of normal and abnormal embryos. |
Meta-topolin improved micropropagation in Syzygium cumini and acclimatization to ex vitro conditionsA. Naaz, S.A. Hussain, M. Anis, A.A. AlatarBiologia plantarum 63:174-182, 2019 | DOI: 10.32615/bp.2019.020 An efficient micropropagation system was developed for a recalcitrant woody tree Syzygium cumini (L.) Skeels using nodal explants excised from 15-d-old aseptic seedlings. The explants were employed on an Murashige and Skoog (MS) medium supplemented with different concentrations (1.0 - 10.0 μM) of cytokinins, such as benzyladenine (BA), kinetin (Kin), meta-topolin (mT), or 2-isopentyl adenine (2ip), either alone or in combination with different concentrations (1.0 - 3.0 μM) of auxins, such as indole-3-acetic acid (IAA), indole-3-butyric acid (IBA), or α-naphthalene acetic acid (NAA). Of the cytokinins tested, mT proved to be best for shoot bud induction and proliferation. Among the tested combinations, a maximum regeneration (90 %) with a mean shoot number of 25.33 ± 0.33 and a shoot length of 5.20 ± 0.11 cm were recorded on the MS medium containing 5.0 μM mT + 2.0 μM NAA after 12 weeks of incubation. Further 4-week incubation on optimum 5.0 μM mT before transfer to a secondary medium consisting of MS + 5.0 μM BA + 2.0 μM NAA yielded up to 51 microshoots with an average length (6.53 cm). For in vitro rooting, healthy shoots (about 5 cm) were excised and incubated on the half or full strength MS medium enriched with different concentrations (1 - 7.5 µM) of NAA. A substantial increase in rhizogenic competency (15 %) was observed in shoots raised on a medium with mT with a mean root number of 6.33 ± 0.10 and a mean length of 5.13 ± 0.21 cm on the half MS supplemented with 5.0 µM NAA after 4 weeks. A maximum of 95 % plantlets regenerated on the medium with mT was successfully acclimatized and established in earthen pots under field conditions. The consistent increases in activities of superoxide dismutase, catalase, glutathione reductase, and ascorbate peroxidase during acclimatization indicate that mT raised plantlets response well to the stress induced by ex vitro conditions. |
Application of abscisic acid prevents leaf senescence at decreased irradianceW. Kupis, E. Tomal, E. NiewiadomskaBiologia plantarum 63:405-410, 2019 | DOI: 10.32615/bp.2019.052 Several lines of evidence suggest that plant hormone abscisic acid (ABA) and the activity of alternative respiratory pathway are somehow interrelated. In this paper, we tested how an application of ABA affects the alternative oxidase (AOX) pathway and leaf senescence in Arabidopsis thaliana (L.) Heynh. Different effects of ABA application on the AOX activity were observed under high irradiance (HI) and low irradiance (LI). The expression of AOX1D gene was stimulated, whereas the expression of senescence marker gene WRKY53 was decreased due to ABA treatment. We also noticed that changes of AOX genes AOX1A and AOX1D, as well as AOX regulatory gene ANAC017, were rather inversely correlated with irradiance-dependent changes in AOX activity. The expression of AOX1D and WRKY53 was diminished due to the application of H2O2 under LI. Our results are indicative that in some conditions an exogenous application of ABA may suppress leaf senescence. This action does not go via the induction of AOX activity, despite stimulation of AOX genes. |
Application of sodium salicylate up-regulates defense responseagainst Fusarium graminearum in wheat spikesM. SORAHINOBAR, V. NIKNAM, A. JAHEDI, H. EBRAHIMZADEH, B. MORADI, M. BEHMANESH, H. SOLTANLOOBiologia plantarum 63:690-698, 2019 | DOI: 10.32615/bp.2019.139 Fusarium head blight caused by the hemibiotrophic fungus Fusarium graminearum is one of the most devastating diseases of wheat which reduces both grain yield and quality. To better understand mechanism underlying wheat resistance to this pathogen, the expressions of five candidate genes encoding phenylalanine ammonia-lyase (PAL), glucanase-2 (Gl 2), class IV chitinase (Cht-4), cytochrome P450 (CYP), and pleiotropic drug resistance (PDR) following spike inoculation with F. graminearum was compared in susceptible cv. Falat and resistant cv. Sumai3 at three time points (48, 96, 144 h after inoculation). Real-time quantitative PCR analysis indicated earlier and greater inductions of PAL, Glu-2, and Cht-4 in spikes of 'Sumai3' as compared to 'Falat' in response to F. graminearum inoculation. The expression of CYP in the resistant 'Sumai3' was about three times higher than in 'Falat' at 144 h after pathogen inoculation. Moreover, soil drench application of sodium salicylate (SA) one day before pathogen inoculation drastically curtailed pathogen infection in both the cultivars. Furthermore, SA treatment caused an induction of these genes in spikes of the susceptible cultivar to show a similar pattern as in the resistant one when inoculated with F. graminearum. Proteomics analysis of F. graminearum treated spikes 96 h after inoculation confirmed an increase of Glu and Cht spot volume in 'Sumai3' whereas a decrease in 'Falat'. The SA treatment also caused significant increases in Glu and Cht spot volumes in both the cultivars. Our findings show an association between SA improvement of wheat defense against F. graminearum infection and induction of genes encoding proteins involved in pathogen response (Glu-2, Cht-4), secondary metabolite biosyntheses (PAL), and xenobiotic detoxification (CYP and PDR). |
Efficient regeneration of Eucalyptus urophylla from seedling-derived hypocotylsZ. -C. Huang, F. -H. Zeng, X. -Y. LuBiologia plantarum 54:131-134, 2010 | DOI: 10.1007/s10535-010-0020-4 Seedling hypocotyls were used as explants to establish a regeneration protocol for Eucalyptus urophylla and N-phenyl-N'-[6-(2-chlorobenzothiazol)-yl] urea (PBU), one kind of di-substituted urea, was found useful growth regulator. The hypocotyls incubated on a modified Murashige and Skoog medium (SPCa), supplemented with 6.6 μM PBU and 0.57 μM indole-3-acetic acid (IAA) dedifferentiated and form calli (100 % after 7 d). Compared with other growth regulator combinations, PBU stimulated more vigorous calli and restrained their darkening. In addition, the calli induced by PBU showed high frequency of adventitious buds formation (57%). Shoot proliferation and elongation was then stimulated on SPCa medium containing 0.44 μM 6-benzyladenine (BA), 0.54 μM naphthalene acetic acid (NAA) and 0.3 μM gibberellic acid (GA3). For rooting, shoots were cultivated on root induction medium containing 2.5 μM indole-3-butyric acid (IBA). Plantlets were then successfully transplanted to greenhouse. |
An efficient and rapid in vitro regeneration system for metal resistant cottonE. Bicakci, A. R. MemonBiologia plantarum 49:415-417, 2005 | DOI: 10.1007/s10535-005-0018-5 In this report we describe the most suitable protocol for callus formation and plant regeneration for cotton. We screened 15 cotton (Gossypium hirsutum L.) genotypes for metal resistance and two of them, Nazilli M-503 (M503) Nazilli 143 (N-143) selected as Cd, Cu and Ni resistant. The cotyledonary nodes from these genotypes were the best explants for regeneration of shoots (more than 90 %) and roots (50 to 70 %). Shoot apex also gave good shoot regeneration (more than 90 %) but their root regeneration efficiency was low (35 %). These results show that Murashige and Skoog (MS) media containing 0.44 μM naphthaleneacetic acid (NAA) and 0.98 μM indole-3-butyric acid (IBA) was the most suitable recipe for getting high shoot and root regeneration from cotyledonary nodes of N-143 and M503 cotton genotypes. |


