biologia plantarum

International journal on Plant Life established by Bohumil Nìmec in 1959

Fulltext search in archive



« advanced mode »

 previous    1   2   3   4   5  6   7   8   9   10   11   ...    next 

Results 121 to 150 of 2232:

Transcriptional properties of eight synthetic pathogen-inducible promoters in transgenic Arabidopsis thaliana

Z. C. Huang, S. Peng, H. Li, F. H. Zeng

Biologia plantarum 61:389-393, 2017 | DOI: 10.1007/s10535-016-0665-8

Synthetic pathogen-inducible promoters (SPIP) hold a great promise to meet the demands for a desired temporal and spatial regulation of transgenes. Four pathogen-inducible cis-elements (F-box, S-box, Gst1-box, and W-box) and the minimal cauliflower mosaic virus 35S (CaMV 35S) promoter (-46 to +8 TATA box) were used to design SPIP. Eight SPIP were synthesized and named FSGW, FSWG, GWFS, GWSF, SFGW, SFWG, WGFS, and WGSF according to the order of cis-element dimers. They were used to replace the CaMV 35S promoter in the plasmid pBI121 to control expression of the β-glucuronidase (gus) gene. The transcriptional properties of each SPIP were evaluated in homozygous T3 lines of transgenic Arabidopsis thaliana by histochemical staining gus expression and real time quantitative PCR. FSGW and FSWG had a very low basal level and a poor inducibility. The other six SPIP showed different levels of background and inducibility. Using Ralstonia solanacearum, the spores of Phytophthora capsici, and salicylic acid as inducing factors, GWSF showed the advantages of a low basal expression, rapid response, and efficient transcriptional activity in the rosette leaves of five-week-old plants. The results indicate that the permutation and combination of the cis-elements had important effects on transcriptional activities of SPIP. Synthetic pathogen-inducible promoters like GWSF are valuable because it can potentially be further improved to apply to plant genetic engineering for disease resistance.

Constitutive expression of SlTrxF increases starch content in transgenic Arabidopsis

F. B. Wang, W. L. Kong, Y. R. Fu, X. C. Sun, X. H. Chen, Q. Zhou

Biologia plantarum 61:494-500, 2017 | DOI: 10.1007/s10535-016-0675-6

The plastidic thioredoxin F-type (TrxF) protein plays an important role in plant saccharide metabolism. In this study, a gene encoding the TrxF protein, named SlTrxF, was isolated from tomato. The coding region of SlTrxF was cloned into a binary vector under the control of 35S promoter and then transformed into Arabidopsis thaliana. The transgenic Arabidopsis plants exhibited increased starch accumulation compared to the wild-type (WT). Real-time quantitative PCR analysis showed that constitutive expression of SlTrxF up-regulated the expression of ADP-glucose pyrophosphorylase (AGPase) small subunit (AtAGPase-S1 and AtAGPase-S2), AGPase large subunit (AtAGPase-L1 and AtAGPase-L2) and soluble starch synthase (AtSSS I, AtSSS II, AtSSS III and AtSSS IV) genes involved in starch biosynthesis in the transgenic Arabidopsis plants. Meanwhile, enzymatic analyses showed that the major enzymes (AGPase and SSS) involved in the starch biosynthesis exhibited higher activities in the transgenic plants compared to WT. These results suggest that SlTrxF may improve starch content of Arabidopsis by regulating the expression of the related genes and increasing the activities of the major enzymes involved in starch biosynthesis.

A protoporphyrinogen oxidase gene expression influences responses of transgenic rice to oxyfluorfen

J. Park, L. H. Tran, S. Jung

Biologia plantarum 61:659-666, 2017 | DOI: 10.1007/s10535-017-0732-9

We compared the defense against photoinhibitions and oxidative stress in transgenic rice expressing a modified Myxococcus xanthus protoporphyrinogen oxidase (MxProtox) gene and in wild-type (WT) rice. Although the MxProtox transgenic lines had higher content of protoporphyrin IX (Proto IX) than the untreated controls, they did not exhibit a drastic accumulation of Proto IX as in the WT after 2 d of 50 μM oxyfluorfen (OF) treatment. In the transgenic lines S4 and S11, the transcriptions of OsProtox and modified MxProtox genes were almost sustained in response to OF, although transcription of OsProtox was greatly down-regulated in the WT. The excess Proto IX in the WT plants treated with OF generated a severe stress mediated by singlet oxygen (1O2), leading to a prominent increases in electrolyte leakage and malondialdehyde production. This stress in the WT necessitated not only a substantial accumulation of zeaxanthin and antheraxanthin, but also strong increases in activities of superoxide dismutase, catalase, and peroxidase as well as transcriptions of CatalaseB, Ascorbate Peroxidase, and Heme Oxygenase2 genes. By contrast, the transgenic plants did not result in any noticeable increase in these parameters. Our results demonstrate that the transgenic rice expressing modified MxProtox efficiently prevented accumulation of photosensitizing Proto IX through sustaining higher transcriptions of porphyrin biosynthetic genes, thereby reducing the stress imposed by OF.

Mobilization of the Tetu1 transposable element of Helianthus annuus: evidence for excision in different developmental stages

M. Fambrini, C. Pugliesi

Biologia plantarum 61:55-63, 2017 | DOI: 10.1007/s10535-016-0655-x

The tubular ray flower (turf) mutant of sunflower is characterized by a switch of ray flowers from zygomorphic to near-actinomorphic disc flowers. In sunflower, floral symmetry of ray and disc flowers is specified by the activity of members of a CYCLOIDEA (CYC) gene family. The turf mutant is generated by the insertion of a CACTA-like transposable element (TE), named Transposable element of turf1 (Tetu1), in the coding sequence of the HaCYC2c gene. The TEinsertion changes the reading frame of turf-HaCYC2c for the encoded protein and leads to a premature stop codon. Tetu1 is a non-autonomous version of a CACTA TEcarrying the minimum sequences necessary for transposition in the presence of autonomous elements in the sunflower genome. In the previous analysis, performed in more than 11 000 plants homozygous for the turf-HaCYC2c allele, the absence of chimerism and the segregation rate of derived-progenies from reverted phenotypes suggest that Tetu1 transpositions are restricted to a time shortly before and/or during meiosis. Here, we report the analysis of F5 and F6 progenies, derived from an F4 progeny of the cross turf × Chrysanthemoides2, where plants with a chimeric inflorescence were detected. Tetu1 showed active excision in all progenies taken into consideration and named High Frequency of Tetu1 Transposition (HFTT). Within a total of 449 plants, Tetu1 excision generated a 13.81 % of non-chimeric revertants but also a 5.12 % of plants with somatic sectors of variable size in the outmost whorl of the inflorescence. These unexpected results suggest variations in tissue specificity and time of TEexcision. The excision of Tetu1 was confirmed by DNA molecular screening of non-chimeric and chimeric revertants and transcription analysis of the HaCYC2c gene. In HFTT progenies, sequence analyses excluded significant DNA changes with respect to the original Tetu1 transposon as well as to the adjacent 5'- and 3'-TE regions. Genetic and epigenetic regulatory mechanisms were proposed to explain the time and frequency of Tetu1 transposition in HFTT progenies.

Influence of water shortage on apple seedling growth under different radiation composition

F.A. HAMANN, A. FIEBIG, G. NOGA

Biologia plantarum 65:88-99, 2021 | DOI: 10.32615/bp.2020.086

Abiotic stresses strongly impair plant development and might impose detrimental effects particularly on seedlings. Irradiance and water deficit are relevant factors, which affect performance of young plants under controlled conditions. In our study, we investigated the influence of water shortage combined with different radiation sources - light emitting diodes (LED) and compact fluorescence lamps (CFL) - on physiological and biochemical parameters of young apple plants. Stress responses were assessed by fluorescence-based indices, while relative water, chlorophyll (Chl), and proline content served as reference parameters. The watering regime had a higher impact on biochemical indicators than the radiation sources. Lower Chl content was determined in plants grown under LED both in control and in water deficit plants. Nitrogen balance index and nitrogen balance index with red radiation excitation showed similar patterns regarding leaf Chl results in relation to the radiation source, being higher under CFL. In contrast, the flavonol index was higher in plants cultivated under LED. Stomatal conductance and maximal photochemical efficiency emphasised a radiation quality effect with higher values for CFL. In conclusion, fluorescence indices related to nitrogen status and flavonol content are promising parameters to sense physiological impairments under the given conditions. However, discrepancies compared to previous studies might be related to the different plant species, the nature of dehydration, and the measuring conditions.

Immunogold-labelling localization of chlorophyllase-2 at different developmental stages of Pachira macrocarpa leaves

T.C. LEE, K.H. LIN, M.Y. HUANG, C.-M. YANG

Biologia plantarum 65:333-341, 2021 | DOI: 10.32615/bp.2021.048

Chlorophyllases (Chlases) are housekeeping proteins in plant cells. The dephytylating enzymes can catalyze chlorophyll (Chl) to form chlorophyllide, but the distribution of Chlases in plant cells is still an interesting debate. Previously, we showed that PmCLH2 was a nuclear-encoded gene, and PmCLH2 protein was located in cytosol and chloroplasts of Pachira macrocarpa (Pm). In this study, the antibody of PmCLH2 was made and used by the immunogold-labelling technique to detect the localization of Chlase of Pm leaves at four developmental stages (young, mature, yellowing, and senescent). The transmission electron microscopy results show that Chlases were comprehensively found in parts of the chloroplast, such as the inner membrane of the envelope, grana, and the thylakoid membrane as well as in cytosol, and vacuoles at young, mature, and yellowing stages of Pm leaves, but not in the cell wall, plasma membrane, mitochondria, and nucleus. In short, PmCLH2 was mainly detected in vacuoles at the senescent stage, but a few were found in the chloroplasts. A pathway is proposed to explain the birth and death of Chl, Chlase, and chloroplasts in higher plants.

Physiological and biochemical changes during graft union formation in Carya illinoinensis

W.C. SU, H.Y. HE, Z.Z. LIU, Z.H. MO, F. CAO, F.R. PENG

Biologia plantarum 65:203-211, 2021 | DOI: 10.32615/bp.2021.023

To reveal the physiological and biochemical mechanism underlying graft union formation in pecan (Carya illinoinensis), dynamic changes in content of nutrients, tannin, and phytohormones together with key enzyme activities were investigated 0, 3, 5, 7, 10, 14, 18, 22, 31, and 40 d after grafting (DAG), in homograft unions. During graft union formation, peroxidase (POD) activity increased at 7 - 10 DAG compared with that at 0 DAG. Polyphenol oxidase (PPO) activity was higher in grafted than ungrafted pecan seedlings (control) at 22 DAG, which was similar to POD activity. The tannin content exhibited a decreasing trend with grafting relative to the control. Indole-3-acetic acid (IAA) and zeatin riboside (ZR) content increased from 7 - 10 DAG, with higher average content than in the control at 14 - 31 DAG. Abscisic acid (ABA), soluble sugar, starch, and soluble protein content was generally lower in grafted plants than in the control. Combined with our previous anatomical observations, these results suggested that, during graft development, some enzymes and growth promoting hormones might be required for callus proliferation at early stage and for vascular reconnection at the later stage. Nutrients provided energy for the whole graft development process. In contrast, some polyphenols and growth inhibiting hormones seemed to have negative effects on this process.

Topical application of double-stranded RNA molecules deriving from Tomato yellow leaf curl virus reduces cognate virus infection in tomato

O. MELITA, A. KALDIS, M. BERBATI, C. REPPA, M. HOLEVA, M. LAPIDOT, D. GELBART, P. OTTEN, A. VOLOUDAKIS

Biologia plantarum 65:100-110, 2021 | DOI: 10.32615/bp.2020.172

Tomato yellow leaf curl virus (TYLCV), a whitefly-transmitted single-stranded DNA (ssDNA) virus, causes the most important viral disease of tomato worldwide. TYLCV-mediated disease is mainly controlled via extensive insecticide sprays aiming at the whitefly vector. RNA-based vaccination was proven to be a non-transgenic approach leading to efficient plant virus control. In this work, double-stranded RNA (dsRNA) molecules deriving from sequences of the C4 and V2 genes of TYLCV-Mild were produced in vitro and topically applied onto tomato plants along with the virus (via agroinfiltration). DsC4 and dsV2 application reduced disease incidence to 23 and 46 %, respectively, while TYLCV positive control reached 64 %. Bioinformatics analysis of the virus-specific small interfering RNAs (vsiRNAs) from TYLCV-infected tomato revealed 'hot' and 'cold' spots in the TYLCV-Mild genome. Interestingly, the viral C-strand had twofold siRNA reads when compared to that of the V-strand. Overall, vsiRNAs of negative and positive polarity were almost equal (53.5 vs. 46.6 %); vsiRNAs of negative polarity prevailed at the V-strand. Stem-loop RT-PCR validated the presence of six vsiRNAs (hot or cold spots) in TYLCV-Mild-infected and dsRNA-treated tomato. The exogenously applied dsRNA was found to rapidly move systemically in tomato and was detected for 54 days post treatment (dpt). The applied dsRNA molecules were successfully processed by the Dicer-like proteins (DCLs) in tomato since small interfering RNAs (siRNAs) deriving from the dsRNA were detected for at least 54 dpt. This consists the first report of dsRNA-based vaccination applied against a monopartite geminivirus.

Overexpression of the Panax ginseng MYB4 gene enhances stress tolerance in transgenic Arabidopsis thaliana

W.H. LIAN, T.X. SUN, X.Y. MENG, R. SUN, F. HUI, Y.N. JIANG, Y. ZHAO

Biologia plantarum 65:27-38, 2021 | DOI: 10.32615/bp.2020.164

The myeloblastosis (MYB) transcription factors are essential for plant stress responses. They can enhance plant tolerance to abiotic stresses (e.g., drought, salinity, and cold) via improved physiological and biochemical responses including the accumulation of metabolites. In this study, we constructed a Panax ginseng MYB4 (PgMYB4) gene expression vector and established the stable transgenic Arabidopsis thaliana lines to study the effects of this gene on plant stress tolerance. The germination rate and seedling taproot length were greater for the PgMYB4-overexpressing plants than for the wild-type plants. Accordingly, the overexpression of PgMYB4 in Arabidopsis enhanced seedling tolerance to drought, salt, and cold conditions. Under drought stress, the relative chlorophyll content decreased less, the proline content increased more, and the water loss rate decreased more in the transgenic plants than in the wild type. The expressions of stress-related genes responsive to dehydration 19A, responsive to dehydration 22, responsive to desiccation 29A, cold-regulated 15A, cold-regulated 47, and pyrroline-5-carboxylate synthase 1 were significantly upregulated in the transgenic Arabidopsis plants. Under high salt stress, the kinesin 1 (KIN1) expression was significantly upregulated in the transgenic plants. In response to the low temperature stress, the dehydration-responsive element binding protein 2A and KIN1 expressions increased dramatically in the transgenic Arabidopsis plants. Thus, PgMYB4 positively regulated the stress tolerance gene networks, which promoted the expression of anti-stress effector genes. This gene may be useful for ginseng breeding programs aiming to develop new cultivars with enhanced stress tolerance.

Transcriptome comparison of physiological divergence between two ecotypes of Portulaca oleracea

M. WU, S. FU, W. JIN, W.Z. XIANG, W.C. ZHANG, L. CHEN

Biologia plantarum 65:212-220, 2021 | DOI: 10.32615/bp.2021.012

According to the survey, wild purslane (Portulaca oleracea L.) has two different ecotypes, one with the red stem living in an arid environment and one with the green stem living in a humid environment. In order to explore the physiological response strategies of plants to environmental changes, these two ecotypes of purslane were selected as experimental materials. Physiological indices were determined and transcriptome analysis was carried out to screen the differentially expressed genes (DEGs) from two ecotypes of purslane. The results showed that the content of soluble sugars, proline, anthocyanins, and chlorophylls was significantly different, and most DEGs belonged to the WRKY and NAC families. Finally, the results of transcriptome analysis were verified by real-time qPCR. Therefore, it can be inferred that the transcription factor (TF) families may play an important role in physiological response strategies by regulating the changes of anthocyanins and osmotic regulators (soluble sugars, proline, etc.) through the abscisic acid signalling pathway. This will accelerate the study of purslane at the molecular level, provide corresponding theoretical support for its artificial domestication, and drought breeding.

Ectopic expression of GmNHX3 and GmNHX1, encoding two Glycine max Na+/H+ vacuolar antiporters, improves water deficit tolerance in Arabidopsis thaliana

E.M. PARDO, L. TOUM, L.S. PÉREZ-BORROTO, L. FLEITAS, J.P. GALLINO, S. VIDAL MACHI, A.VOJNOV, A.P. CASTAGNARO, B. WELIN

Biologia plantarum 65:157-166, 2021 | DOI: 10.32615/bp.2021.003

The importance of Na+/H+ antiporters in salt tolerance in plants has been demonstrated in many studies, but much less is known about their protective role during drought stress. To study their possible contribution to water deficit tolerance, two closely related soybean Na+/H+ antiporters belonging to the intracellular NHX exchanger protein family, GmNHX3 and GmNHX1, were evaluated in transgenic Arabidopsis thaliana. A. thaliana plants ectopically expressing GmNHX3 or GmNHX1 displayed a more drought-tolerant phenotype compared to wild-type plants, which was accompanied by an increase in relative water content and chlorophyll content during stress conditions. Both GmHNX1 and GmHNX3 transgenic lines accumulated higher amounts of Na+ and K+ cations, showed increased antioxidant enzyme activities and less membrane damage due to lipid peroxidation under water deficit, as compared to non-transformed plants. Furthermore, plants expressing GmNHX3 showed an increased sensitivity to abscisic acid as deduced from stomatal closure and seed germination inhibition studies. Finally, a significant up-regulation of abiotic stress-related genes was observed in both transgenic lines compared to wild-type plants in response to abscisic acid and mannitol treatments. These results demonstrate that GmNHX3 and GmNHX1 antiporters confer protection during drought stress in A. thaliana and hence are potential genetic targets to improve drought tolerance in soybean and other crops.

Molecular cloning and functional analysis of the thioredoxin gene SikTrxh from Saussurea involucrata

L. ZHANG, C. LIU, F.F. CHENG, X.Y. GUO, Y.X. LI, A.Y. WANG, J.B. ZHU

Biologia plantarum 65:47-59, 2021 | DOI: 10.32615/bp.2020.155

Thioredoxins are oxidoreductases that help to maintain redox homeostasis in plants under abiotic stress. In this study, a new thioredoxin gene, SikTrxh, was cloned from Saussurea involucrata (Kar. & Kir.), a perennial herb that grows in the high alpine mountains of Central Asia. Bioinformatics analysis shows that the full-length cDNA of SikTrxh consisted of 565 bp with a 354-bp open reading frame and encoded a 117 amino acid protein. Using quantitative reverse transcription (RT) PCR, we found that the expression of the SikTrxh gene was induced by salt, cold, and drought stresses, suggesting that this protein played a significant role in plant defense. Subcellular localization confirmed that the protein was localized to the mitochondria. A vector carrying SikTrxh was inserted into tobacco, and successfully modified plants were identified by RT-PCR. Physiological indicators and antioxidant enzyme activities were measured under low temperature, and salt and drought stresses. Our results show that malondialdehyde content and relative electrolyte leakage increased in both wild-type and SikTrxh-overexpressing transgenic plants; however, these increases were significantly higher in the wild-type plants than in the transgenic plants. We also found that photosystem II photoinhibition was lower in the transgenic plants than in the wild-type plants, and that activities of reactive oxygen species-scavenging enzymes were higher in the transgenic plants than in the wild-type plants. We conclude that SikTrxh can reduce toxic effects of reactive oxygen species to protect the plasma membrane, thereby increasing plant resistance to abiotic stresses.

Methyl jasmonate elicitation of common bean seedlings induces nucleotidase activity and the expression of several nucleotidase genes in radicles

G. GALVEZ-VALDIVIESO, M. GARMENDIA-CALVO, M. PINEDA, P. PIEDRAS

Biologia plantarum 65:246-254, 2021 | DOI: 10.32615/bp.2021.017

Nucleotides are the basic elements of the genetic material, participate in bio-energetic processes, are cofactors and components of secondary metabolites, etc. Nucleotide hydrolases (nucleotidases) are phosphatases that remove the 5'-phosphate group from the nucleotides and play a crucial role in nucleotide metabolism. In this study, genes encoding putative nucleotidases in Phaseolus vulgaris have been identified, and the effect of methyl jasmonate (MeJA) on both nucleotidase activity and gene expression has been addressed. The predicted nucleotidase peptides include the conserved domains characteristic of the haloacid dehalogenase-like hydrolase superfamily. The analysis of the expression of the 11 identified genes in radicles of common bean seedlings elicited with MeJA showed that 3 of them are highly induced by this phytohormone in a dose-dependent manner. Nucleotidase activity in radicles from MeJA treated plants was higher than in not elicited seedlings, and this induction was observed with all the nucleotides assayed (mono-, di- or triphosphate) and with purine or pyrimidine nucleotides. MeJA is involved in biotic and abiotic stress, and the induction of nucleotide metabolism in response to this treatment suggests a relevant role for nucleotides in the seedlings response to unfavourable conditions.

Rapid and efficient leaf regeneration propagation system for Euonymus bungeanus

K. NING, T. ZHOU, C.Z. JIANG, H.M. WU, J.L. JIANG, J. CHEN, Y.A. El-KASSABY, Y. MA

Biologia plantarum 65:118-125, 2021 | DOI: 10.32615/bp.2020.166

Rapid propagation of plants by tissue culture is of great significance for large-scale production, molecular genetics research, and breeding. Currently, a rapid and high-efficient tissue culture protocol for Euonymus bungeanus is needed. To develop a propagation system for this species, we established a new regeneration system from leaves. Callus formation was induced on Murashige and Skoog (MS) medium supplemented with 0.5 mg dm-3 6-benzylaminopurine (6-BA) and 0.5 mg dm-3 α-naphthalene acetic acid (NAA) and the induction rate almost reached 100 % under red radiation within 21 d. The medium for proliferation of adventitious buds comprised of MS medium with 1.0 mg dm-3 6-BA and 0.5 mg dm-3 NAA, and the induction rate within 20 d nearly reached 100 %. When, the adventitious buds were transferred to the rooting medium containing 1/2MS, 2.0 mg dm-3 indole-3-butyric acid (IBA), and 0.05 mg dm-3 NAA, adventitious root formation was achieved within 20 d. Collectively, the rapid and high-efficient regeneration system from E. bungeanus leaves was established, providing useful references for effective mass propagation and it could serve as an enabling technology for future genetic engineering.

Expression of γ-tocopherol methyltransferase gene from Brassica napus increased α-tocopherol content in soybean seed

D. F. Chen, M. Zhang, Y. Q. Wang, X. W. Chen

Biologia plantarum 56:131-134, 2012 | DOI: 10.1007/s10535-012-0028-z

A cDNA encoding γ-tocopherol methyltransferase from Brassica napus (BnTMT) was overexpressed in soybean [Glycine max (L.) Merr.] under the control of seed-specific promoter of Arabidopsis fatty acid elongase 1 (FAE1) or soybean glycinin G1. Two and three transgenic plants were selected, respectively, after Agrobacterium-mediated transformation. Polymerase chain reaction (PCR) and Southern blots confirmed that BnTMT was single-copy integrated into the genome of transgenic plants. RT-PCR analysis showed that the expression of BnTMT was higher in the immature cotyledons than in the mature cotyledons, while no expression was detected in the leaves. Moreover, the expression level under the control of FAE1 was higher than that of G1. HPLC analysis indicated that the seed-specific expression of BnTMT resulted in 11.1-fold and 18.9-fold increase in α- and β-tocopherol content, respectively, in T2 seed. These results suggested that introducing BnTMT into soybean can be used to increase the vitamin E composition in seeds.

Transcriptome analysis of developing castor bean seeds and identification of ricinoleic acid biosynthesis genes

Z.-T. WU, F. XU, L.-L. YU, Y. OUYANG, X.-X. GENG

Biologia plantarum 65:273-282, 2021 | DOI: 10.32615/bp.2021.033

Ricinoleic acid is a kind of unsaturated fatty acids in oil of castor bean (Ricinus communis) seeds with wide application value. However, there is little transcriptomic information on genes related to ricinoleic acid biosynthesis in castor beans. To better understand the regulation mechanism of ricinoleic acid biosynthesis, immature seeds at three developmental stages (S1, S2, and S3 corresponding to 15, 30, and 45 d after pollination) were collected. The results indicated that the accumulation of castor bean oil and ricinoleic acid increased gradually during seed development, and reached the maximum value at the late stages of seed development (45 d after pollination). Furthermore, RNA sequencing was conducted to analyze the transcriptome of the developing seeds at three developmental stages. Totals of 9 875 differentially expressed genes (DEGs) were identified among the three time points. Based on the annotation information, 49 DEGs related to lipid biosynthesis were screened among all DEGs. Through cluster analysis of the 49 DEGs, ten genes with increasing FPKM values from seed development stages S1 to S3 were selected as candidate key enzymes, since they showed similar patterns of increase with castor bean oil accumulation and ricinoleic acid biosynthesis during seed development. The transcriptomic data of the 10 candidate key enzyme genes was further validated by RT-qPCR. Ultimately, a putative model of key genes correlated with ricinoleic acid accumulation was built. Our study identified a series of key genes and revealed the proposed molecular mechanism of ricinoleic acid accumulation in castor bean seeds through the transcriptional analysis. It broadens our knowledge of ricinoleic acid biosynthesis and castor bean oil accumulation and also provides a theoretical foundation for the genetic engineering key genes that can improve the ricinoleic acid production in castor beans as well as in other plants.

Microtubule interaction of LICC1, a maize homologue of a component of the human muskelin/RanBPM/CTLH protein complex

M. MIQUEL, D. PAGÈS-VILA, C.M. VICIENT

Biologia plantarum 65:126-130, 2021 | DOI: 10.32615/bp.2020.168

MRCTLH (muskelin/RanBPM/CTLH) is a protein complex found in humans (MRCTLH) that is involved in the regulation of numerous cellular processes, such as gluconeogenesis, cell signaling, development, nuclear extrusion, cell morphology, or stability of different proteins. According to genomic data, all eukaryotes have similar protein complexes. In yeast, a similar protein complex named GID was found to be involved in the regulation of gluconeogenesis. LICC1 is a maize protein whose sequence resembles that of TWA1 in humans and GID8 in yeast, which are central components of the MRCTLH and GID complexes. LICC1 contains three highly conserved protein domains, LisH, CTLH, and CRA, typical of this protein family. Twa1 and gid8 are unique genes in human and yeast genomes. However, three copies of licc1 are present in the maize genome and multiple copies are present in other plant genomes. This result suggests the presence of multiple variants of the MRCTLH/GID complex in plants, which could increase its regulatory capacity. We also demonstrate here that LICC1 has the ability to interact with microtubules, similarly to the human TWA1. This interaction reinforces the idea that the LICC1 protein from maize, and its homologues in plants and, in general, the GID/MRCTLH complex in plants, can perform biological functions similar to those in humans and yeast.

Potassium silicate combined with glycine betaine improved salt tolerance in Dalbergia odorifera

L.-J. ZHANG, E.H.M. CISSE, Y.-J. PU, L.-F. MIAO, L.-S. XIANG, W. XU, F. YANG

Biologia plantarum 65:323-332, 2021 | DOI: 10.32615/bp.2021.044

Salinity has a huge negative impact on plant growth and development by increasing sodium ions accumulation and potassium ions loss that deeply disturbs the plant cell homeostasis and can lead to plant cell death. The imbalance between Na+ and K+ could be solved by applying potassium silicate (K2SiO3). The glycine betaine (GB) is well-known to play a crucial role against oxidative stress in plants by improving the antioxidant machinery. Thus, this research aimed to apply K2SiO3 (1 mM) and GB (10 mM) alone or in combination against 200 mM NaCl-induced damages in Dalbergia odorifera. The results showed a significant amelioration of negative effects of salt stress on the phenotypic traits, chlorophyll content, net photosynthetic rate, stomatal conductance, transpiration rate, and water use efficiency by applied substances. The contents of saccharides and proline were down-regulated by K2SiO3, GB, and K2SiO3-GB, whereas the proteins content was increased by these treatments. The contents of lipid peroxidation, superoxide anion, hydrogen peroxide were reduced by exogenous substances under stress. The activities of antioxidant enzymes (superoxide dismutase, peroxidase, and catalase) and the accumulation of antioxidants (glutathione and ascorbate) were enhanced by exogenous substances. The K2SiO3-GB combination mostly showed better effects on antioxidant machinery compared to a single treatment.

Cloning PIP genes in drought-tolerant vetiver grass and responses of transgenic VzPIP2;1 soybean plants to water stress

S. B. Hu, Q. Zhou, J. An, B. J. Yu

Biologia plantarum 60:655-666, 2016 | DOI: 10.1007/s10535-016-0631-5

Vetiver grass [Vetiveria zizanioides (L.) Nash] displays comprehensive abiotic stress tolerance closely related to fine maintenance of plant water relation mediated by plasma membrane intrinsic proteins (PIPs). Two open reading frame sequences of PIPs (867 and 873 bp) were cloned from vetiver grass and named as VzPIP1;1 and VzPIP2;1, respectively. Expression of green fluorescent protein revealed only subcellular localization of VzPIP2;1 in the plasma membrane. Agrobacterium tumefaciens mediated transgenic (VzPIP2;1) soybean plants had a higher water content in above-ground parts under sufficient water supply through enhancing transpiration as compared to the non-transgenic plants but displayed a more severe drought injury because of a lower photosynthesis and a higher transpiration rate. However, A. rhizogenes mediated transgenic soybean plants kept a higher water content in above-ground parts by improving root water transport and kept a more effective photosynthesis under normal and drought conditions.

Spermine alleviates heat-induced senescence in creeping bentgrass by regulating water and oxidative balance, photosynthesis, and heat shock proteins

L.L. LIANG, Y.Q. CAO, D. WANG, Y. PENG, Y. ZHANG, Z. LI

Biologia plantarum 65:184-192, 2021 | DOI: 10.32615/bp.2021.008

Spermine (SPM) is involved in response to abiotic stress in plants, but the potential role of SPM in regulating senescence has not been well documented. Objectives of this study were to examine the effect of changes in endogenous polyamines (PAs) by SPM application on improving heat tolerance of creeping bentgrass (Agrostis stolonifera) and explore the SPM-regulated senescence associated with alterations of water and oxidative balance, photosynthesis, and heat shock proteins under heat stress. The results showed that persistent high temperature caused severe oxidative damage and significant decreases in chlorophyll (Chl) content, photosynthetic efficiency, and leaf water content leading to premature senescence in creeping bentgrass, as reflected by a significant upregulation of transcriptions of senescence-associated genes (AsSAG39, Ash36, and Asl20). The improvement of endogenous spermidine (SPD) and SPM content induced by SPM application could significantly alleviate heat stress damage to creeping bentgrass through maintaining higher Chl content, net photosynthetic rate, photochemical efficiency, and performance index on absorption basis, promoting osmotic adjustment ability and antioxidant enzyme (superoxid dismutase, catalase, peroxidase, and ascorbate peroxidase) activities to enhance the scavenging capacity of reactive oxygen species, and upregulating transcriptions of heat shock protein (HSP) genes (HSP90-5, HSP90.1-b1, HSP82, HSP70, HSP26.7, HSP17.8, and HSP12) helping to maintain normal synthesis and functions of proteins under high temperature stress, thereby delaying heat-induced leaf senescence. These findings reveal an important role of PAs in regulating senescence in perennial plants exposed to a high temperature environment.

Isolation and characterization of a tonoplast Na+/H+ antiporter from the halophyte Nitraria sibirica

L. Wang, Y. K. Ma, N. N. Li, W. B. Zhang, H. P. Mao, X. F. Lin

Biologia plantarum 60:113-122, 2016 | DOI: 10.1007/s10535-015-0560-8

Na+/H+ exchanger (NHX)-mediated Na+ and H+ antiport is an important mechanism for salt tolerance in plants. In this study, an Na+/H+ antiporter gene, referred to as NsNHX1, was isolated from the halophyte Nitraria sibirica Pall. using degenerate polymerase chain reaction (PCR) and rapid amplification of cDNA ends (RACE). The resulting 2 182 bp NsNHX1 cDNA contained a 1 635 bp open reading frame (ORF) that encoded 544 amino acids and showed striking sequence similarity to tonoplast-localized NHXs from other plants. Subcellular localization analysis confirmed NsNHX1 to be a tonoplast-localized protein. Cis-elements described as being responsive to biotic and abiotic stresses were present in the NsNHX1 promoter region, and reverse transcription (RT)-PCR analysis confirmed that NsNHX1 expression was induced by exogenous abscisic acid (ABA), cold, and NaCl. Transcription of NsNHX1 increased sharply 3 h after treatment with 200 mM NaCl revealing that NsNHX1 responded rapidly to the salt stress. Overexpression of NsNHX1 enhanced salt tolerance in transgenic Arabidopsis thalliana L. suggesting that NsNHX1-mediated Na+ compartmentalization played an important role in enhancing plant salt tolerance.

Beyond osmolytes and transcription factors: drought tolerance in plants via protective proteins and aquaporins

S. S. Hussain, M. T. Iqbal, M. A. Arif, M. Amjad

Biologia plantarum 55:401-413, 2011 | DOI: 10.1007/s10535-011-0104-9

Mechanisms of drought tolerance have been studied by numerous groups, and a broad range of molecules have been identified to play important roles. A noteworthy response of stressed plants is the accumulation of novel protective proteins, including heat-shock proteins (HSPs) and late embryogenesis abundant (LEA) proteins. Identification of gene regulatory networks of these protective proteins in plants will allow a wide application of biotechnology for enhancement of drought tolerance and adaptation. Similarly, aquaporins are involved in the regulation of water transport, particularly under abiotic stresses. The molecular and functional characterization of protective proteins and aquaporins has revealed the significance of their regulation in response to abiotic stresses. Herein, we highlight new findings regarding the action mechanisms of these proteins. Finally, this review also surveys the current advances in engineering drought tolerant plants, particularly the engineering of protective proteins (sHSPs and LEA) and aquaporins for imparting drought stress tolerance in plants.

Some key physiological and molecular processes of cold acclimation

R. John, N. A. Anjum, S. K. Sopory, N. A. Akram, M. Ashraf

Biologia plantarum 60:603-618, 2016 | DOI: 10.1007/s10535-016-0648-9

Agricultural production worldwide has been severely impacted by cold and freezing stresses. Plant capacity to acclimate to environmental conditions in their immediate vicinity largely control their survival, growth, and productivity. Molecular as well as biochemical mechanisms underpinning plant cold acclimation are very complex and interwoven. The cold-impacted plants try to modulate expression of variety genes controlling cell membrane lipid composition, mitogen-activated protein kinase cascade, total soluble proteins, polyamines, glycinebetaine, proline, reactive oxygen species (ROS) scavengers, cryoprotectants, and a large number of cold responsive factors. To this end, this paper dissects the array of transcriptional factors/genes down- or up-regulated, their identification in different plant species, recognition of cold tolerant/resistant transgenic plants, complexity of the mitogen-activated protein kinase cascade, as well as their cross talk under different stresses and molecular mechanisms. Furthermore, it also comprehensively elucidates physio-biochemical interferences in cold acclimation with a particular emphasis on endogenous content as well as exogenously supplied different types of polyamines, ROS, and osmoprotectants. Overall, low temperature stress tolerance or cold acclimation varies greatly among species depending on the stress intensity and duration and type of plant species.

Stability of sheath blight resistance in transgenic ASD16 rice lines expressing a rice chi11 gene encoding chitinase

T. Rajesh, S. Maruthasalam, K. Kalpana, K. Poovannan, K. K. Kumar, E. Kokiladevi, D. Sudhakar, R. Samiyappan, P. Balasubramanian

Biologia plantarum 60:749-756, 2016 | DOI: 10.1007/s10535-016-0594-6

Development of transgenic plants by introducing defense genes is one of the strategies to engineer disease resistance. Transgenic ASD16 rice plants harbouring rice chitinase chi11 gene, belonging to a PR-3 group of defense gene conferring sheath blight (Rhizoctonia solani Kuhn) resistance, were used in this study. Three T2 homozygous lines (ASD16-4-1-1, 5-1-1, and 6-1-1) were identified from seven putative (T0) transgenic lines expressing chi11 using Western blotting analysis. The inheritance of sheath blight resistance in those lines was studied over generations. The stability of chi11 expression up to T4 generation in all the three homozygous lines was proved by Western blot and the stability of sheath blight resistance in the homozygous lines was proved up to T4 generation using detached leaf and intact leaf sheath assays. Among the three homozygous lines tested, ASD16-4-1-1 showed consistent results in all the generations and gave a better protection against the sheath blight pathogen than the other two lines.

VvZFP11, a Cys2His2-type zinc finger transcription factor, is involved in defense responses in Vitis vinifera

Y.-H. Yu, X.-Z. Li, Z.-J. Wu, D.-X. Chen, G.-R. Li, X.-Q. Li, G.-H. Zhang

Biologia plantarum 60:292-298, 2016 | DOI: 10.1007/s10535-016-0598-2

In plants, many C2H2-type zinc finger transcription factors function in plant defense responses to biotic and abiotic stresses. Here, we report cloning and characterization of VvZFP11 which encoded a C2H2-type zinc finger protein (ZFP) in grapevine (Vitis vinifera). Sequence analysis shows that VvZFP11 contained one L-box, two C2H2-type zinc finger motifs and one ERF-associated amphiphilic repression (EAR) motif. The VvZFP11 localized to the nucleus and functional analysis shows that full-length VvZFP11 had no transcriptional activity, but VvZFP11 lacking the EAR motif had a strong transcriptional activity in yeast. In grapevine, expression of VvZFP11 was induced by salicylic acid and methyl jasmonate and also quickly responded to infection with Erisiphe necator. Arabidopsis thaliana plants overexpressing VvZFP11 were more resistant to Golovinomyces cichoracearum, and real time quantitative polymerase chain reaction revealed that defense-related genes AtPR1 and AtPDF1.2 were up-regulated in the overexpressing lines. These results suggest that VvZFP11 might play an important role in defense responses in grapevine.

Overexpression of LeMYB1 enhances shikonin formation by up-regulating key shikonin biosynthesis-related genes in Lithospermum erythrorhizon

H. Zhao, Q. S. Chang, D. X. Zhang, R. J. Fang, H. Zhao, F. Y. Wu, X. M. Wang, G. H. Lu, J. L. Qi, Y. H. Yang

Biologia plantarum 59:429-435, 2015 | DOI: 10.1007/s10535-015-0512-3

We previously reported that LeMYB1 might be a crucial transcription factor in regulating shikonin formation in Lithospermum erythrorhizon. In this study, by overexpressing LeMYB1 under the control of CaMV35S promoter in L. erythrorhizon hairy roots, we further clarified the role of LeMYB1 in the shikonin formation and its regulation. The LeMYB1-overexpressing transgenic hairy roots were successfully induced by infecting seedling nodes with Agrobacterium rhizogenes strain ATCC15834 that carried the pBI121-LeMYB1 vector. The LeMYB1 transcripts were significantly up-regulated in the transgenic hairy root lines compared with the wild type lines, and the total content of shikonin and its derivatives was dramatically enhanced by the LeMYB1 overexpression. Real-time PCR results reveal that the enhanced shikonin biosynthesis in the overexpressing lines were mainly caused by a highly up-regulated expression of genes coding key enzymes (PAL, HMGR, and PGT) and key regulators (LeDI-2 and LePS-2) involved in the shikonin biosynthesis. Overall, our results suggest that LeMYB1 plays a positive role in regulating the shikonin biosynthesis in L. erythrorhizon.

Overexpression of the repressor gene PvFRI-L from Phyllostachys violascens delays flowering time in transgenic Arabidopsis thaliana

S. N. Liu, L. F. Zhu, X. C. Lin, L. Y. Ma

Biologia plantarum 60:401-409, 2016 | DOI: 10.1007/s10535-016-0614-6

The gene FRIGIDA (FRI) is floral repressor and plays a key role in the timing of Arabidopsis flowering. To study the function of FRI-like genes in bamboo, we isolated a FRI family gene from bamboo Phyllostachys violascens and named it PvFRI-L. Sequence alignment and phylogenetic analysis show that the PvFRI-L protein belongs to the FRL3 (III) subfamily from monocots and contains a conserved FRIGIDA domain. PvFRI-L was located in the nucleus of onion epidermal cells. PvFRI-L was expressed in all tested organs of flowering and non-flowering bamboo plants with a higher expression in non-flowering than in flowering plants. Overexpression of PvFRI-L in Arabidopsis caused late flowering by downregulating flowering locus T and upregulating flowering locus C. A P-box, the binding site involved in gibberellin response, was found only in the promoter region of PvFRI-L but not in that of FRI. Furthermore, PvFRI-L expression in the leaves of Ph. violascens seedlings was downregulated with gibberellic acid treatment. Taking together, our observation suggests that PvFRI-L may be flowering repressor and its delaying floral timing may be regulated by gibberellic acid in bamboo.

Silver nanoparticles with different concentrations and particle sizes affect the functional traits of wheat

S. WANG, B. D. WU, M. WEI, J. W. ZHOU, K. JIANG, C.Y. WANG

Biologia plantarum 64:1-8, 2020 | DOI: 10.32615/bp.2019.122

The response of functional traits of plants to external environment can influence their competitive ability because these functional traits are required for the acquisition of resources. The overuse of silver nanoparticles (AgNPs) has gained attention due to their environmental toxicity. This study aimed to examine the effects of AgNPs with different concentrations and particle sizes on functional traits of wheat. It was observed that AgNPs significantly reduced the plant height and so decrease its competitive ability. Ag ions decreased leaf chlorophyll and nitrogen content and specific leaf area more than AgNPs, but the opposite was true for leaf length, single leaf fresh mass, and shoot fresh mass. Hence, the toxicity of AgNPs may be higher than that of Ag ions in some cases. In this study, leaf chlorophyll and nitrogen content decreased with increasing concentration of AgNPs (with size 30 nm). The AgNPs with smaller particle size exerted higher toxicity on leaf chlorophyll and N content than those with larger particle size at the same concentration. However, AgNPs with larger particle size reduced more aboveground fresh mass than those with smaller particle size at the same concentration.

Effect of virus inducible cis-element insertion on transcription properties of improved GWSF promoter in Arabidopsis thaliana

Z.C. HUANG, H. LI

Biologia plantarum 64:320-323, 2020 | DOI: 10.32615/bp.2020.032

An ideal synthetic promoter can accurately regulate gene expression and the minimal cauliflower mosaic virus 35S promoter (GWSF) is an ideal synthetic pathogen-inducible promoter (SPIP) with several advantages. Three modified SPIPs, named as VGWSF, GWVSF, and GWSFV according to the arrangement of cis-elements, were optimized by inserting the dimer of a virus inducible cis-element (TTGGGAAGGAATTTCCTACT, V-box) upstream, midstream, or downstream the GWSF sequence. The three promoters were used to replace the cauliflower mosaic virus 35S promoter in the plasmid pBI121 in order to control the expression of the β-glucuronidase (gus) gene. Transformation of Arabidopsis thaliana (ecotype Col‑0) plants was performed via the Agrobacterium tumefaciens strain GV3101 by the floral dip method. The five-week-old transgenic T3 lines were histochemically stained for GUS activity to evaluate the transcriptional properties of modified SPIPs. The VGWSF and GWVSF had low basal expressions and could not be induced by low or high temperatures and a low osmotic potential but could be induced by the tobacco mosaic virus (TMV). Although GWSFV had the highest GUS activity, it showed a substantial basal expression. After being treated with TMV, abscisic acid (ABA), salicylic acid (SA), or ethylene (Eth) for12 h, the expressions of modified SPIPs were evaluated by real-time quantitative PCR. With the basal expression of GWSF as a reference, each treatment was represented as log2 (fold to the GWSF basal level). The basal expression of VGWSF and expressions induced by TMV, ABA, SA, and Eth were 1.39, 3.42, 6.01, 4.14, and 2.26, respectively, whereas the corresponding values of GWVSF were 1.16, 4.07, 3.72, 4.65, and 3.98, respectively, and the corresponding values of GWSFV were 4.43, 6.11, 4.83, 3.69, and 3.34, respectively. The results revealed that three modified SPIPs acquired virus induction activity due to the insertion of V-box. The V-box insertion position had a significant impact on transcription properties of modified SPIPs.

A rapid translocation of photoassimilates from source organs maintains grain yield in cowpea subjected to drought stress during grain filling

C. EGASHIRA, Y. HASHIGUCHI, E. KURAUCHI, Y. TATSUMI, A.C.S. NAKAGAWA, N. HAMAOKA, T. YUASA, M. IWAYA-INOUE, Y. ISHIBASHI

Biologia plantarum 64:529-534, 2020 | DOI: 10.32615/bp.2019.129

We examined the influence of drought stress during grain filling on grain yield to investigate changes in assimilates in sink and source organs. When plants were subjected to drought stress from the start of grain filling until harvest, the photosynthetic rate rapidly decreased. Grain dry mass during maturation was not significantly different between the control and drought-stressed plants. Under drought stress conditions, starch content in source organs (peduncle, leaf, petiole, stem, and root) was significantly lower than in corresponding organs of control plants; the greatest difference was seen in leaves. Consistent with this observation, α- and β-amylase activities in leaves significantly increased within the first 6 d of drought stress. We conclude that in cowpea subjected to drought stress during grain filling, the grain yield is maintained, despite a dramatic decrease in photosynthetic rate, by translocation of photoassimilates from source organs.

 previous    1   2   3   4   5  6   7   8   9   10   11   ...    next