Maize crops are sensitive to NaCl stress, which is one of the most harmful abiotic stresses affecting agricultural productivity. To gain further insights into the differential metabolic responses to NaCl stress, we employed metabolomics and physiological approaches to understand the response of salt-tolerant (PH6WC) and sensitive (PH4CV) cultivars of maize. Salt stress caused a significant reduction in root growth, lower root numbers, softened roots, leaf etiolation, inhibition of leaf formation, and decreased shoot height and stem width in both the tolerant and sensitive genotypes compared with the control. These morphological characteristics increased with the progression of the NaCl concentration, however, they were less prominent in the salt-tolerant genotype. Evans blue staining demonstrated that NaCl-induced root cell death, and the root cells of 'PH4CV' were almost completely dead following 9 d of exposure to 100 mM NaCl. Under treatment with 100 mM NaCl, 79 compounds in the roots of 'PH4CV' were identified as being significant metabolites, and 85 compounds were identified as being significant metabolites in the roots of 'PH6WC'. The NaCl-induced changes in the metabolomes of these two maize cultivars indicate that 80 root-based compounds were different between NaCl-treated plants and controls. Among these metabolites, 30 were found in both maize cultivars when responding to NaCl stress. These compounds were associated with the metabolism of some basic compounds such as cis-9-palmitoleic acid, L-pyroglutamic acid, galactinol, deoxyadenosine, and adenine. The changing abundance of the 30 metabolites was not completely consistent in 'PH4CV' and 'PH6WC'. Glucose metabolism was exclusively induced by NaCl in the 'PH4CV' maize seedlings whereas nucleic acid metabolism was more significant in the 'PH6WC' maize seedlings in response to NaCl stress. Overall, 'PH6WC' and 'PH4CV' responded differently to NaCl stress, and this information is helpful in understanding how maize seedlings respond to this type of abiotic stress.

Potato (Solanum tuberosum L.) is among the top staple foods in the world, and salinity adversely affects its yield and quality. To improve salt tolerance in potato, the present study is focused on the Agrobacterium-mediated transformation of potato by the Atriplex canescens betaine aldehyde dehydrogenase (BADH) gene driven by single, double, and triple CaMV 35S promoters. The study led first to the detection of seven lines containing the BADH gene followed by the identification of T-DNA insertions via DNA hybridization and enzyme-linked immunosorbent assays. The salt tolerance was found to be promoter dependent, as the lines with triple promoters showed a higher resistance than those tranformed with single and double promoters. The transgenic lines showed lower content of H₂O₂ and malondialdehyde and a lower relative electrical conductivity than wild-type plants. Furthermore, these lines also showed higher proline and chlorophyll content. In silico analysis confirmed that the A. canescens BADH protein had a remarkable tendency to interact with sodium ions and water molecules like other BADH proteins. Taken together, the overexpression of BADH under triple CaMV 35S promoters enhanced salt tolerance of potato.

An excess of aluminum (Al) is a major factor limiting crop production in acidic soils. Secretion of organic acids (OAs) from the root apex of diverse plant species or genotypes via activation of anion channels has been recognized as the most important mechanism of Al exclusion. Citric, oxalic, and malic acids are the most effective OAs in detoxifying Al. In this review, we summarize biochemical properties of OAs secreted by plants. We also highlight the molecular mechanisms of Al signal perception, Al transport, signal regulators associated with OAs secretion, as well as interactions between Al and hormone signaling pathways. Based on a comprehensive understanding of the relationship between signal modulators and regulation of expression of relevant genes, a signal transduction model for Al-induced OAs secretion is proposed.

Seed germination and following seedling growth are largely affected by environmental conditions. However, the genes involved in adaptations to these conditions are largely unknown. In this study, we cloned and characterized an Arabidopsis uridine diphosphate glycosyltransferase gene UGT76E12 and investigated its function in seed germination and plant growth under adverse environments. We found that UGT76E12 gene expression was induced by NaCl, mannitol, and abscisic acid (ABA) treatments. Under these treatments, the UGT76E12 overexpression lines exhibited a delayed seed germination and cotyledon growth compared with a wild type, and this delayed growth could be restored by treatment with sodium tungstate, an ABA synthesis inhibitor. Further, real-time quantitative PCR analysis reveals that the stress-induced expressions of genes involved in ABA biosynthesis were greatly enhanced in the UGT76E12 overexpression lines. Therefore, our data suggest that the UGT76E12 gene plays an important role in regulation of seed germination and growth under adverse environmental conditions by affecting ABA biosynthesis.

London plane (Platanus acerifolia Wild.) is a famous landscape plant because of its numerous desirable traits except the abundant pollens and seed hairs, which not only pollute the environment but also affect human health. To resolve these problems, we herein isolated and functionally analyzed the promoter of PlacSEP1.1, an orthologous gene of Arabidopsis SEPALLATA1, and investigated the potential usability for cell ablation strategies to engineer reproductive sterility in plants. A 2130 bp 5' upstream region of PlacSEP1.1 was isolated and termed pPlacSEP1.1. Putative motif detections show that there were several types of motifs in pPlacSEP1.1 including core promoter elements, tissue-specific expression regulatory elements, and some negative regulatory elements. β-Glucuronidase histochemical and quantitative assay showed that pPlacSEP1.1 of all deletions was active in all detected tissues except the shortest deletion D5 in roots. In order to test whether pPlacSEP1.1 could be used for London plane sterility breeding with a cytotoxic gene Barnase, the pPlacSEP1.1::Barnase and pPlacSEP1.1::Barnase-mic35S-Barstar vectors were constructed and transformed into tobacco. The pPlacSEP1.1::Barnase transgenic tobacco showed serious defects with respect to vegetative development and died within a couple of weeks after transplantation. On the other hand, most pPlacSEP1.1::Barnase-mic35S-Barstar transgenic tobacco showed normal vegetative growth and inflorescence, and flower development prevented phenotype.

γ-Aminobutyric acid (GABA) regulates plant tolerance to abiotic stresses; however, a transcriptomic change and key stress-related genes induced by GABA have not been investigated in plants during a prolonged period of salt stress. Roots of creeping bentgrass (Agrostis stolonifera) cv. Penncross were pretreated with or without 0.5 mM GABA solution for 2 days and then subjected to salt stress for 20 days (150 mM NaCl solution for 3 d, 200 mM NaCl for another 3 d, and 250 mM NaCl for 14 d) in controlled growth chambers. The application of GABA significantly increased GABA content in roots and alleviated a salt-stress induced decrease in GABA content in leaves. This was associated with a significant increase in salt tolerance as demonstrated by a significantly higher leaf relative water content, photochemical efficiency, performance index on absorption basis, and lower electrolyte leakage in GABA-pretreated plants as compared to untreated plants under salt stress. Transcriptomic analysis found that GABA-induced salt tolerance was closely associated with saccharide, amino acid, and lipid metabolism. The GABA upregulated key differentially expressed genes including cytochrome P450 (CYP450), zinc transporter 29 (ZTP29), alpha-amylase 3 (AMY3), 3-ketoacyl-CoA synthase 6 (KCS6), aldehyde oxidase (AO), acetyl-CoA carboxylase 1 (ACC1), and magnesium-chelatase (Mg-CHT) involved in zinc homeostasis, starch degradation, and the biosynthesis of wax, fatty acid, chlorophyll, and abscisic acid, which could contribute to GABA-regulated salt tolerance. Current findings prove that GABA application is an efficient approach to enhance salt tolerance of creeping bentgrass during a prolonged period of salt stress and also provide valuable information to better understand key candidate genes and regulatory pathways of GABA-induced salt tolerance in plants.

Sodium cation compartmentalization into vacuoles is one of the effective strategies for adaptation of halophytes to saline environments. Tonoplast Na⁺/H⁺ antiporter (NHX) is involved in Na⁺ sequestration into vacuoles under salt stress. However, the function of NHX in halophyte Iris lactea is still unclear. In this study, a significant positive correlation was observed between Na⁺ accumulations and IlNHX expression in tissues under 0 - 200 mM NaCl, indicating IlNHX might be responsible for Na⁺ accumulation of I. lactea under salt stress. More important, IlNHX was specifically localized to the tonoplast. Transgenic tobacco expressing IlNHX grew better and showed higher tolerance to 200 mM NaCl than respective wild type (WT). Compared to WT, transgenic tobacco accumulated more Na⁺ and K⁺ and maintained higher K⁺/Na⁺ ratios in tissues, accompanied by the reduction of chlorophyll loss and lipid peroxidation in the presence of NaCl. Moreover, transgenic tobacco exhibited markedly higher vacuolar H⁺-ATPase (V-ATPase) activity relative to WT when subjected to salt stress. The findings suggest that transgenic plants overexpressing IlNHX could compartmentalize more Na⁺ into vacuoles in tobacco via enhanced V-ATPase activity, which further contributes to maintaining K⁺ and Na⁺ homeostasis, to improved photosynthesis, and to protection of cell membrane integrity under salt stress.

Leaf venation and coupled physiological function of wild plants co-evolve during the natural selection. How artificial selection affects leaf vein traits and coordinated physiological functions of main crops are largely unknown. This study examined the changes of leaf vein traits and their correlation with gas exchange of flag leaves and yield in eight wheat genotypes of differing ploidy under the same growing conditions. The results indicate that flag leaf vein density (VLA), major-vein density (VLA_major), and minor-vein density (VLA_minor) decreased whereas the proportion of minor-vein length and interveinal distance between small longitudinal veins (IVD) increased during the polyploidization process, and the major advance occurred from the period from diploids to tetraploids. The VLA, VLA_major, and VLA_minor were closely coordinated with maximum net photosynthetic rate (P_N) and photosynthetic N use efficiency (PNUE), but not with stomatal conductance. The proportion of minor-vein length and IVD were negatively related with P_N and PNUE but positively related with N content per area (N_area) during wheat evolution. A higher proportion of minor-vein length and IVD, and a lower VLA_major in flag leaves along with a larger N_area were largely responsible for the increased yield in modern cultivars. The decreased redundancy of leaf vein density and increased minor-vein proportion in modern cultivars can confer a yield advantage during wheat evolution.

The roles of ethylene responsive factors (ERFs) and their positive and negative regulations of abiotic stress tolerance have been widely reported. This study reports the characterization of ItERF from Iris typhifolia Kitag with respect to molecular and functional properties. The 867 bp cDNA fragment of ItERF was cloned by reverse transcription PCR from I. typhifolia. Real-time quantitative PCR revealed that ItERF expression was induced in the roots, stems, and leaves of I. typhifolia after NaCl treatment, and that ItERF expressions were significantly higher in the leaves and roots than in the stems. A green fluorescent protein marker revealed that ItERF was located to the nucleus. Plant survival and root growth of ItERF transgenic Arabidopsis thaliana L. seedlings were much better than those of the wild type under NaCl stress. Malondialdehyde content in the transgenic lines was significantly lower than that in the wild type. Growth of yeast transformants showed an enhanced tolerance to salt stress than non-transformed yeast cells. All of the results verified that the expression of ItERF had effects on plant growth under salt stress.

The class III PRX family is a class of heme-containing oxidases and plays important roles in response to abiotic stress in plants. The responses to abiotic stresses could be regulated by phytohormones like abscisic acid (ABA) and methyl jasmonate (MeJA). In this research, 11 CsPRXs genes in tea plant (Camellia sinensis) were cloned and analyzed. Based on the similarity of the sequences, they were classified into 5 sub-groups. According to the results of reverse transcription PCR, CsPRX55 presented the highest expression in roots compared to stems and leaves of both tea cultivars LJ43 and Baiye 1. Besides, the expressions of CsPRX12 and CsPRX73 were highest in roots, while CsPRX4, CsPRX47, and CsPRX72 were highest in stems of 'Baiye 1'. But most of CsPRXs showed the highest expressions in leaves of 'LJ43'. CsPRXs appeared different expression patterns under drought stress of tea plants which were pre-treated with ABA or MeJA for three days. In 'LJ43' and 'Baiye 1', there were 3 CsPRXs and 7 CsPRXs up-regulated by exogenous ABA and MeJA, respectively. However, CsPRX4 and CsPRX16 were down-regulated in 'LJ43' treated with ABA and MeJA. It suggested that CsPRXs possessed diverse functions in response to hormones and abiotic stress. In 'LJ43', the activity of peroxidase (POD) was increased when pre-treated by ABA and MeJA, and the highest activity appeared after 24 and 12 h, respectively. In 'Baiye 1', the activity of POD was also increased, however, when pre-treated by MeJA, the peak-time of POD activity was at 24 h. But the change had no obvious rule after ABA treatment. Exogenous ABA or MeJA may play a role in protecting tea plants suffered from drought stress via regulating some CsPRXs expressions and increasing POD activity.

Drought resistance in plants can be associated with four different strategies to cope with water stress. These strategies are classified as drought escape, avoidance, tolerance, and recovery. The expression of each strategy depends on plant species and its genetic potential, but also on the environmental conditions, including the stress intensity and duration. Often, prolonged drought conditions are associated with drought escape or avoidance, whereas short but severe drought periods induce drought tolerance. To analyze the components of drought resistance in forage grasses, we applied two Lolium multiflorum/Festuca arundinacea introgression forms into a comprehensive research. Obtained results clearly show that the response of plants to severe short term drought conditions with limited rhizosphere did not reflect their response to long progressive drought conditions, which did not limit root growth. The BC4-INT-40 introgression form with extensive and deep roots was characterized by a more efficient drought avoidance and regeneration mechanisms under long-term drought, whereas the BC4-INT-66 form with shorter roots revealed a lower productivity and re-growth capacity under the prolonged drought. On the other hand, this form had also a better photosynthetic performance under short and intensive drought conditions with a limited space for root development.

Protein synthesis is a ubiquitous and essential process in all organisms, including plants. It is primarily regulated at translation initiation stage which is mediated through a number of translation initiation factors (eIFs). It is now becoming more apparent that in addition to synthesis of proteins, eIFs also regulate various aspects of plant development and their interaction with environment. Translation initiation factors, such as eIF3, eIF4A, eIF4E, eIF4G, and eIF5A affect different processes during vegetative and reproductive growth like embryogenesis, xylogenesis, flowering, sporogenesis, pollen germination, etc. On the contrary, eIF1A, eIF2, eIF4, and eIF5A are associated with interaction of plants with different abiotic stresses, such as high temperature, salinity, oxidative stress, etc. Similarly, eIF4E and eIF4G have roles in interaction with many viruses. Therefore, the translation initiation factors are important candidates for improving plant performance and adaptation. A large number of genes encoding eIFs can functionally be validated and utilized through genetic engineering approaches for better adaptability and performance of plants by inhibiting/minimizing or increasing expression of desired eIF(s).

Tissue/organ-specific promoters are important tools in genetic engineering and crop molecular breeding. They are well characterized in dicots, such as Arabidopsis, tobacco, and tomato, but not sufficiently in monocots, especially in wheat. In this study, the genes specifically expressed in seven different tissues, including coleoptile, root, leaf, pistil, anther, embryo, and endosperm were identified through analyzing the public transcriptome data from a wheat microarray using the ROKU method. The expression patterns of selected genes were validated by reverse transcription polymerase chain reaction. The results showed that these selected genes were expressed specifically or preferentially in each representative tissue/organ. Moreover, the function of their promoters was verified by transient expression in wheat or stable transformation in Arabidopsis. The results showed that these promoters can efficiently and predominantly drive uidA (β-glucuronidase) reporter gene expression in different tissues. Due to their tissue-specific nature, these promoters can be used as potential candidates in plant genetic engineering.

Transient heterologous gene expression in two model plant species, Nicotiana benthamiana and N. excelsior, has been used to study the localization of the heterologous Δ9 acyl-lipid desaturase (Δ9 desaturase) of Synechococcus vulcanus in different cell compartments and its functional activity in the cases of the cytosol, chloroplast, and endoplasmic reticulum (ER) localization. The functional activity and substrate specificity of the heterologous desaturase under the conditions of transient expression have been confirmed by comparison of fatty acid (FA) profiles. The Δ9 desaturase, responsible for the synthesis of oleic and palmitoleic acids, has also been shown to strongly promote the accumulation of polyunsaturated FAs. The results convincingly demonstrate that the Δ9 desaturase of the thermophilic cyanobacterium transiently expressed in two Nicotiana species considerably alters lipid metabolism in their leaves towards a higher FA unsaturation. The functional activity of Δ9 desaturase depends on both the model plant species, N. benthamiana or N. excelsior, and the cellular localization of the enzyme. The method of transient expression of heterologous genes in plants is highly effective, inexpensive, and not time-consuming, which makes it attractive for estimating the functional activity and/or substrate specificity of heterologous desaturases.

Cadmium (Cd) is a highly toxic and widespread soil pollutant, which negatively affects various aspects of plant growth and physiology. Here, the role of photosynthesis in response to Cd was investigated in the Cd-tolerant pea (Pisum sativum L.) mutant SGECd^t. The wild type SGE and the mutant SGECd^t were grown in a hydroponic solution supplemented with 1, 3, or 4 µM CdCl₂ for 12 d. Root and shoot biomasses of the Cd-treated SGECd^t were significantly higher than of SGE. Cadmium had little effect on the quantum yield of photosystem II (φPSII) and chlorophyll content of intact leaves of both pea genotypes. However, when leaf slices were taken from Cd-exposed plants and incubated with high Cd concentrations, the SGECd^t mutant showed 1.5 - 2 times higher φPSII values than SGE, with genotypic differences maximal at 0.1 and 1 mM CdCl₂. In contrast, when leaf slices were taken from plants previously unexposed to Cd, both pea genotypes exhibited similar φPSII values. Cadmium content in leaves and mesophyll protoplasts of Cd-treated SGECd^t were about 2 - 3 times higher than in SGE ones. The mutant leaves and mesophyll protoplasts had also higher Ca, Mg, Mn, and Zn content. Thus, SGECd^t acclimated to Cd during growth in the Cd-supplemented nutrient solution by developing a molecular mechanism related to photosynthetic integrity. A higher foliar nutrient content likely allows enhanced photosynthesis by counteracting the damage of leaves caused by Cd.

Ferredoxin-thioredoxin reductase (FTR) is an iron-sulfur protein that supplies electrons from photochemically reduced ferredoxin (Fd) to thioredoxin (Trx) in the ferredoxin/thioredoxin system in chloroplasts. The FTR is a heterodimer with a variable subunit (FTRv) and a catalytic subunit (FTRc). The function of FTRv is not well known. In petunia (Petunia hybrida), FTRv is a single-copy gene, which is named PhFTRv. In this study, the spatio-temporal expression of PhFTRv in petunia was analyzed, and PhFTRv transcription was found to be high in leaves and stems. A tobacco rattle virus gene silencing was used in this study. Virus induced gene silencing-mediated PhFTRv silencing resulted in large yellow-green leaves, delayed flowering, and reduced cold tolerance in petunia plants.

Heat stress is one of the most crucial factors affecting crop growth and productivity worldwide. So, searching for a potent eco-friendly heat stress alleviator is the main issue nowadays. The current study was conducted to assess the ameliorative effects of 1.5 mM potassium silicate (K₂SiO₃, further only Si) or 1.66 mM silicon dioxide nanoparticles (SiNPs) on wheat (Triticum aestivum L.) seedlings exposed to heat stress (45 °C, 4 h). The observations show that Si or SiNPs treatments significantly restored the heat stress-provoked ultrastructural distortions of cellular organelles, particularly chloroplasts and the nucleus. Further, both Si and SiNPs enhanced the photosynthetic capacity as revealed by increments in the photochemical efficiency of photosystem II and the performance index as well as the content of photosynthetic pigments. A reduction in malondialdehyde accumulation in Si and SiNPs treated plants was positively related to their membrane stability index. The reverse transcription PCR analysis showed that Si treatment but not SiNP treatment stimulated the overexpressions of both Triticum aestivum plasma membrane intrinsic protein (TaPIP1) and Triticum aestivum nodulin 26-like intrinsic protein (TaNIP2) aquaporin genes parallelly with an improvement in the relative water content. This investigation reveals that Si was more effective than SiNPs in restoring the heat stress injuries. To the best of our knowledge, this is the first investigation exploring the effects of Si and SiNPs in improving thermotolerance of wheat seedlings.

Uridine diphosphate glucose dehydrogenase (UGDH) is a key enzyme in the hemicellulose and pectin biosynthesis pathway and participates in the regulation of growth and development in plants. In this study, we isolated a BpUGDH gene from paper mulberry (Broussonetia kazinoki × Broussonetia papyifera) and analyzed its function and expression characteristics. The results show that the BpUGDH was expressed in all organs of paper mulberry with a higher expression in stems than in leaves and roots. A pBpUGDH::GUS gene construct was highly expressed in transgenic Arabidopsis thaliana seedlings, and its expression was induced by a low temperature, methyl jasmonate, gibberellin A₃, ethylene, and auxin. The overexpression of BpUGDH increased the soluble sugar content, promoted the accumulation of hemicellulose, and enhanced the vegetative growth of transgenic plants. These results provide a basis for regulating the growth and adaptability of paper mulberry and improving its utilization value via genetic modification of the BpUGDH gene.

Wheat (Triticum aestivum L.) is leading cereal crop worldwide, but its yield is highly affected due to various diseases, especially Fusarium head blight (FHB), which affects the metabolism of plants. The present study was conducted at the Agricultural Institute Osijek using three winter wheat cultivars (Apache, Bezostaya1, and U1) during 2016/2017. The objectives of our studies were to examine differences in physiological characteristics of FHB resistance among wheat cultivars in the early stage of infection. The FHB incidence and severity was the highest in 'Bezostaya1'. Results suggest that activation of some anti-oxidative enzymes in the first 2 h after Fusarium attack was not efficient to prevent disease. 'Apache', which revealed an average FHB incidence, efficiently activated defence response through phenol metabolism elevation. The most effective defence response trough activation of anti-oxidative enzymes triggered by H₂O₂ was revealed in 'U1', which resulted in a minimal FHB incidence and disease severity. The obtained results confirm differences in defence strategies of wheat genotypes.

In plants, auxin/indoleacetic acid (Aux/IAA) proteins are transcriptional regulators, which regulate developmental process and responses to phytohormones and stress treatments. A previous study has shown that the rice Aux/IAA transcription factor gene OsIAA18 is induced by salt and osmotic stresses. However, little is known about the regulatory functions of this gene. In this study, the OsIAA18 gene was successfully cloned from rice. Subcellular localization analysis in onion epidermal cells indicated that OsIAA18 was localized to the nucleus. Expression analysis in yeast showed that the full length OsIAA18 exhibited transcriptional activation. Heterologous expression of OsIAA18 significantly enhanced salt and osmotic tolerance in transgenic Arabidopsis plants. Real-time quantitative PCR analysis showed that constitutive expression of OsIAA18 up-regulated genes involved in abscisic acid (ABA) biosynthesis, proline biosynthesis, stress responses, and reactive oxygen species scavenging under salt and osmotic stresses. Enzymatic analyses found that the transgenic plants had higher 9-cis-epoxycarotenoid dioxygenase, pyrroline-5-carboxylate synthase, superoxide dismutase, and peroxidase activities than wild-type plants under salt and osmotic stresses. In the transgenic plants, ABA and proline content significantly increased, whereas H₂O₂ and malondialdehyde content significantly decreased. In addition, the transgenic plants had also a lower electrolyte leakage and water loss rate. These overall results indicate that the OsIAA18 gene is involved in enhancing salt and osmotic tolerance in transgenic Arabidopsis plants. The OsIAA18 gene has a potential to be used to enhance the tolerance to abiotic stresses in other plant species.

Festulolium cultivars are widely utilized in Lithuania because they are persistent under abiotic stresses and are high yielding. However, changing climate challenges the existing Festulolium cultivars to adapt to new growing conditions and still maintain the yield. In this study, we aimed at evaluating the yield stability of two Festulolium cultivars in field trials under fluctuating Lithuanian conditions. The mean total dry matter yield (DMY) of both Festulolium cultivars fluctuated greatly between the years and ANOVA analysis showed a significant effect of environment on total DMY as well as DMY of each cut, but the genotype × environment interaction was not significant. There was a high difference between the total DMY of 1^st year and 2^nd year of use of plots in each year of observation. The highest DMYs were harvested in the years 2015 and 2016. Dry matter yield of the 1^st cut was the largest component of the total DMY for most of the years. The plants overwintered the first winter after sowing very well over the whole study period, resulting in excellent spring growth. The winter survival scores of 2^nd year of use of plots were lower than 1^st year of use and strongly correlated with the 1^st cut DMY of 2^nd year of use (r = 0.81). Spring growth of plants at 2^nd year of use was poorer, the correlation between winter survival and spring growth of 2^nd year of use was 0.62. The scores of regrowth after the cuts of 1^st and 2^nd years of use were very similar for most of the experimental years and moderately correlated with the sum of DMYs after cuts (r = 0.55 and r = 0.5, respectively).

Pyramiding transgenes of interest is one of the strategies to engineer multiple stress resistance in crop plants. Transgenic plants which stably express different genes can be hybridized to bring these genes together in one plant. Transgenic rice (Oryza sativa L. cv. ASD 16) plants harbouring genes Xa21 (conferring bacterial blight resistance), tlp (conferring resistance to sheath blight), or gna (conferring resistance to brown planthopper) were used in hybridization experiments. Sexual hybridization was carried out in two different gene combinations: Xa21 × gna and tlp × gna. Molecular analyses were carried out to confirm the presence of transgenes. In F₁ generation, lines harbouring either gene in each of the cross-combination were selected and forwarded to F₂ generation. The presence of genes in F₂ generation was confirmed by PCR, Southern blot hybridization, and Western blotting. The F₂ progeneis harbouring Xa21 and gna exhibited resistance against bacterial blight and moderate resistance against brown planthopper. Similarly, the F₂ lines of tlp and gna combination provided resistance against sheath blight and moderate resistance against brown planthopper. The level of resistance observed in pyramided lines for insect or pathogens was comparable to the resistance observed in their parental lines. Our study shows that pyramiding genes by hybridization between transgenic plants could be one of the strategies to develop cultivars with multiple biotic stress resistances.

Mannose (MAN), an important monosaccharide, contributes to coping with abiotic stresses in plants. Objectives of this study were to examine whether exogenous MAN (30 mM) could significantly increase drought tolerance and further to reveal MAN-regulated tolerance mechanism in white clover under osmotic stress induced by 18 % (m/v) polyethylene glycol 6000 for 10 d in controlled growth chambers. Results show that the application of MAN significanlty alleviated stress damage and the inhibition of growth and photosynthesis in white clover under osmotic stress. The MAN-induced increase in endogenous MAN content and the accumulation of organic osmolytes (proline and water soluble sugars) could be responsible for a lower osmotic potential (OP) in white clover. The exogenous application of MAN also enhanced antioxidant enzyme (superoxide dismutase, peroxidase, ascorbate peroxidase, dehydroascorbate reductase, and glutathione reductase) activities and maintained ascorbic acid content in white clover during osmotic stress. As concern chlorophyll (Chl) metabolism, the MAN-treated plants showed significantly higher transcription of genes involved in Chl synthesis Mg-chelatase and protochlorophyllide reductase and lower transcription of pheophorbide a oxygenase and chlorophyllase related to Chl degradation and also a senescence associated gene 101 than untreated plants. In addition, the MAN application increased transcription of SK2-, Y2K-, and Y2SK-type dehydrin genes, and dehydrin b in leaves of white clover under osmotic stress. These results indicate that MAN plays important roles in drought tolerance not only acting as a compatible solute for OP but also delaying leaf senescence through enhancing antioxidant metabolism, decreasing Chl degradation, and increasing transcription of dehydrin genes contributing to enhanced drought tolerance in white clover.

Interspecific and intergeneric hybridization within the Festuca-Lolium complex is frequently used in forage plant breeding. However, little is known about the natural occurrence and competitiveness of such hybrids. We collected naturally formed hybrids between Festuca apennina, Festuca pratensis, and Lolium perenne in different habitats of Switzerland and the British Isles and studied their origin, the ease of their spontaneous formation, and their competitiveness with parental species. A special attention was paid to the largely sterile triploid forms and their rare sexual progeny. The triploid hybrid F. apennina × F. pratensis proved to be widespread and often highly competitive in Swiss permanent pastures. The majority of these hybrids originated from F. apennina as the seed parent although little or no F. apennina grew nearby. In an experimental setting with ample F. pratensis pollen provided by neighbouring plants, up to 20 % of seeds from open pollinated F. apennina plants were interspecific hybrids; among seeds collected in natural habitats, only 0.35 % were hybrids. At an experimental site at 1 000 m altitude, these triploid hybrids grew much more vigorously than corresponding tetraploid pure F. apennina, confirming their great competitiveness at such altitudes in permanent grasslands. The triploid hybrids were only marginally fertile suggesting that vegetative propagation by rhizomes is the cause of their competitive success in grassland. Moreover, triploid progeny retained the chromosome constitution of their mother plants indicating the possibility of apomixis. Natural triploid F. pratensis × L. perenne hybrids were partially female fertile (a seed set of 0.1 % or less) whereas diploid hybrids did not produce any viable seeds. Progenies of these triploids showed considerable chromosome alterations, such as loss of a genome or recombination due to homoeologous pairing, and only rarely the chromosome constitution of the triploid mother plant was retained. It was concluded that natural triploid interspecific hybrids could expand the range of their progenitor species and might function as bridges transferring genes between them.

The response of functional traits of plants to external environment can influence their competitive ability because these functional traits are required for the acquisition of resources. The overuse of silver nanoparticles (AgNPs) has gained attention due to their environmental toxicity. This study aimed to examine the effects of AgNPs with different concentrations and particle sizes on functional traits of wheat. It was observed that AgNPs significantly reduced the plant height and so decrease its competitive ability. Ag ions decreased leaf chlorophyll and nitrogen content and specific leaf area more than AgNPs, but the opposite was true for leaf length, single leaf fresh mass, and shoot fresh mass. Hence, the toxicity of AgNPs may be higher than that of Ag ions in some cases. In this study, leaf chlorophyll and nitrogen content decreased with increasing concentration of AgNPs (with size 30 nm). The AgNPs with smaller particle size exerted higher toxicity on leaf chlorophyll and N content than those with larger particle size at the same concentration. However, AgNPs with larger particle size reduced more aboveground fresh mass than those with smaller particle size at the same concentration.

An ideal synthetic promoter can accurately regulate gene expression and the minimal cauliflower mosaic virus 35S promoter (GWSF) is an ideal synthetic pathogen-inducible promoter (SPIP) with several advantages. Three modified SPIPs, named as VGWSF, GWVSF, and GWSFV according to the arrangement of cis-elements, were optimized by inserting the dimer of a virus inducible cis-element (TTGGGAAGGAATTTCCTACT, V-box) upstream, midstream, or downstream the GWSF sequence. The three promoters were used to replace the cauliflower mosaic virus 35S promoter in the plasmid pBI121 in order to control the expression of the β-glucuronidase (gus) gene. Transformation of Arabidopsis thaliana (ecotype Col‑0) plants was performed via the Agrobacterium tumefaciens strain GV3101 by the floral dip method. The five-week-old transgenic T₃ lines were histochemically stained for GUS activity to evaluate the transcriptional properties of modified SPIPs. The VGWSF and GWVSF had low basal expressions and could not be induced by low or high temperatures and a low osmotic potential but could be induced by the tobacco mosaic virus (TMV). Although GWSFV had the highest GUS activity, it showed a substantial basal expression. After being treated with TMV, abscisic acid (ABA), salicylic acid (SA), or ethylene (Eth) for12 h, the expressions of modified SPIPs were evaluated by real-time quantitative PCR. With the basal expression of GWSF as a reference, each treatment was represented as log₂ (fold to the GWSF basal level). The basal expression of VGWSF and expressions induced by TMV, ABA, SA, and Eth were 1.39, 3.42, 6.01, 4.14, and 2.26, respectively, whereas the corresponding values of GWVSF were 1.16, 4.07, 3.72, 4.65, and 3.98, respectively, and the corresponding values of GWSFV were 4.43, 6.11, 4.83, 3.69, and 3.34, respectively. The results revealed that three modified SPIPs acquired virus induction activity due to the insertion of V-box. The V-box insertion position had a significant impact on transcription properties of modified SPIPs.

We examined the influence of drought stress during grain filling on grain yield to investigate changes in assimilates in sink and source organs. When plants were subjected to drought stress from the start of grain filling until harvest, the photosynthetic rate rapidly decreased. Grain dry mass during maturation was not significantly different between the control and drought-stressed plants. Under drought stress conditions, starch content in source organs (peduncle, leaf, petiole, stem, and root) was significantly lower than in corresponding organs of control plants; the greatest difference was seen in leaves. Consistent with this observation, α- and β-amylase activities in leaves significantly increased within the first 6 d of drought stress. We conclude that in cowpea subjected to drought stress during grain filling, the grain yield is maintained, despite a dramatic decrease in photosynthetic rate, by translocation of photoassimilates from source organs.

The miR399 is a conserved microRNA (miRNA) family, and it has been characterized as an essential regulator of phosphorus transport in plants. However, the biological function of miR399 in Cunninghamia lanceolata is still largely unclear. In this study, the comparison of mature miR399 sequence revealed a high similarity between Arabidopsis thaliana and C. lanceolate, and the pre-miR399 was capable of forming a typical stem-loop hairpin structure. A gene PHOSPHATE 2 (PHO2) was identified as a target of cln-miR399 using 5' rapid amplification of cDNA ends. Furthermore, the relationship between cln-miR399 and PHO2 was further confirmed through a transient co-expression of both genes in Nicotiana benthamiana. To examine the function of miR399 in Arabidopsis, miR399-overexpressing transgenic Arabidopsis thaliana was acquired using Agrobacterium-mediated approach. Real-time PCR showed that the amount of cln-MIR399 transcripts was higher in miR399-overexpressing plants than in wild-type plants, which was accompanied with down-regulation of expression of its target gene AtPHO2. The P content was 1.40 to 1.56-fold higher in the leaves of three transgenic lines than in wild type plants. However, the P content in the roots of the three transgenic lines was 24.5 - 37.2 % less than that in wild type plants. Moreover, the transcriptions of three phosphate transporter genes (PHT1, PHT2, and PHT3) were up-regulated in roots of miR399-overexpressing Arabidopsis plants. Interestingly, the transgenic lines exhibited retarded growth under normal P conditions compared with the wild type. Our findings demonstrate that cln-miR399 may play crucial roles in P transport and plant growth via regulation of its target gene PHO2.

Chilling stress is a major abiotic factor that limits the growth and productivity of melon (Cucumis melo L.). The application of nitric oxide (NO) can enhance plant tolerance to chilling stress; however, the underlying molecular mechanisms for this process remain poorly understood. In this study, RNA sequencing was performed on melon seedlings exposed to control conditions, chilling stress, or chilling stress in the presence of NO donor sodium nitroprusside (SNP), to identify NO-mediated transcript changes in response to chilling stress. The results identified 488, 1 012, and 1 589 differentially expressed genes (DEGs) between plants in optimum conditions (CK) and chilling stress (CS) groups, plants in the CS and chilling stress + SNP (CN) groups, and those in CK and CN groups, respectively. Through gene ontology (GO) database and Kyoto encyclopedia of genes and genomes (KEGG) enrichment analyses, the DEGs were classified as predominantly involved in saccharide metabolism, biosynthesis of other secondary metabolites, lipid metabolism, amino-acid metabolism, and signal transduction pathways. In addition, 39 genes related to sugar metabolism including those encoding UDP-glucuronate-4-epimerase, β-glucosidase, glucuronosyltransferase, α-1,4-galacturonosyl transferase, and hexokinase, were upregulated in the CK vs. CS comparison, and genes encoding fructose-bisphosphate aldolase and glucan-endo-1,3-β-glucosidase were upregulated in the CS vs. CN, and CK vs. CN comparisons. A gene encoding an EREBP-like factor was upregulated in the CK vs. CS, CS vs. CN, and CK vs. CN comparisons. The expression profiles of 10 selected genes were analyzed using real-time quantitative PCR, and the candidate gene expression patterns were consistent with the DEG classification from RNA-seq. Overall, the data provide insight into the transcriptional regulation by exogenous NO in the response of melon seedlings to chilling stress. The data from this study are relevant for further research on the molecular mechanisms that underlie chilling resistance in melon plants.

Di-n-butyl phthalate (DBP) is one of the frequently detected phthalates in environmental samples. The effects of phthalates are extensively studied in the animals but the effects on plants are scarce. Therefore, the present study is aimed to envisage the effects of DBP on the antioxidative defense system in Hordeum vulgare L. seedlings grown under laboratory conditions for 7 d. The activities of different antioxidative enzymes were enhanced in the shoots. In the roots, the activity of guaiacol peroxidase increased and the catalase activity decreased initially but increased at higher DBP concentrations, whereas the activities of superoxide dismutase, ascorbate peroxidase, and glutathione reductase declined. Furthermore, the content of polyphenols elevated after exposure of seedlings to DBP. The possible reason for these responses of barley seedlings is the oxidative burst, i.e., enhanced production of reactive oxygen species, which were confirmed using confocal microscopy in terms of loss in plasma membrane integrity. DBP also disturbed the normal stomatal morphology of barley seedlings. The study may help to provide insights into the defense of crop plants against phthalate stress.