biologia plantarum

International journal on Plant Life established by Bohumil Nėmec in 1959

Fulltext search in archive



« advanced mode »

 previous    1   2   3   4   5   6  7   8   9   10   11   ...    next 

Results 151 to 180 of 2239:

Isolation and characterization of a tonoplast Na+/H+ antiporter from the halophyte Nitraria sibirica

L. Wang, Y. K. Ma, N. N. Li, W. B. Zhang, H. P. Mao, X. F. Lin

Biologia plantarum 60:113-122, 2016 | DOI: 10.1007/s10535-015-0560-8

Na+/H+ exchanger (NHX)-mediated Na+ and H+ antiport is an important mechanism for salt tolerance in plants. In this study, an Na+/H+ antiporter gene, referred to as NsNHX1, was isolated from the halophyte Nitraria sibirica Pall. using degenerate polymerase chain reaction (PCR) and rapid amplification of cDNA ends (RACE). The resulting 2 182 bp NsNHX1 cDNA contained a 1 635 bp open reading frame (ORF) that encoded 544 amino acids and showed striking sequence similarity to tonoplast-localized NHXs from other plants. Subcellular localization analysis confirmed NsNHX1 to be a tonoplast-localized protein. Cis-elements described as being responsive to biotic and abiotic stresses were present in the NsNHX1 promoter region, and reverse transcription (RT)-PCR analysis confirmed that NsNHX1 expression was induced by exogenous abscisic acid (ABA), cold, and NaCl. Transcription of NsNHX1 increased sharply 3 h after treatment with 200 mM NaCl revealing that NsNHX1 responded rapidly to the salt stress. Overexpression of NsNHX1 enhanced salt tolerance in transgenic Arabidopsis thalliana L. suggesting that NsNHX1-mediated Na+ compartmentalization played an important role in enhancing plant salt tolerance.

Beyond osmolytes and transcription factors: drought tolerance in plants via protective proteins and aquaporins

S. S. Hussain, M. T. Iqbal, M. A. Arif, M. Amjad

Biologia plantarum 55:401-413, 2011 | DOI: 10.1007/s10535-011-0104-9

Mechanisms of drought tolerance have been studied by numerous groups, and a broad range of molecules have been identified to play important roles. A noteworthy response of stressed plants is the accumulation of novel protective proteins, including heat-shock proteins (HSPs) and late embryogenesis abundant (LEA) proteins. Identification of gene regulatory networks of these protective proteins in plants will allow a wide application of biotechnology for enhancement of drought tolerance and adaptation. Similarly, aquaporins are involved in the regulation of water transport, particularly under abiotic stresses. The molecular and functional characterization of protective proteins and aquaporins has revealed the significance of their regulation in response to abiotic stresses. Herein, we highlight new findings regarding the action mechanisms of these proteins. Finally, this review also surveys the current advances in engineering drought tolerant plants, particularly the engineering of protective proteins (sHSPs and LEA) and aquaporins for imparting drought stress tolerance in plants.

Some key physiological and molecular processes of cold acclimation

R. John, N. A. Anjum, S. K. Sopory, N. A. Akram, M. Ashraf

Biologia plantarum 60:603-618, 2016 | DOI: 10.1007/s10535-016-0648-9

Agricultural production worldwide has been severely impacted by cold and freezing stresses. Plant capacity to acclimate to environmental conditions in their immediate vicinity largely control their survival, growth, and productivity. Molecular as well as biochemical mechanisms underpinning plant cold acclimation are very complex and interwoven. The cold-impacted plants try to modulate expression of variety genes controlling cell membrane lipid composition, mitogen-activated protein kinase cascade, total soluble proteins, polyamines, glycinebetaine, proline, reactive oxygen species (ROS) scavengers, cryoprotectants, and a large number of cold responsive factors. To this end, this paper dissects the array of transcriptional factors/genes down- or up-regulated, their identification in different plant species, recognition of cold tolerant/resistant transgenic plants, complexity of the mitogen-activated protein kinase cascade, as well as their cross talk under different stresses and molecular mechanisms. Furthermore, it also comprehensively elucidates physio-biochemical interferences in cold acclimation with a particular emphasis on endogenous content as well as exogenously supplied different types of polyamines, ROS, and osmoprotectants. Overall, low temperature stress tolerance or cold acclimation varies greatly among species depending on the stress intensity and duration and type of plant species.

Stability of sheath blight resistance in transgenic ASD16 rice lines expressing a rice chi11 gene encoding chitinase

T. Rajesh, S. Maruthasalam, K. Kalpana, K. Poovannan, K. K. Kumar, E. Kokiladevi, D. Sudhakar, R. Samiyappan, P. Balasubramanian

Biologia plantarum 60:749-756, 2016 | DOI: 10.1007/s10535-016-0594-6

Development of transgenic plants by introducing defense genes is one of the strategies to engineer disease resistance. Transgenic ASD16 rice plants harbouring rice chitinase chi11 gene, belonging to a PR-3 group of defense gene conferring sheath blight (Rhizoctonia solani Kuhn) resistance, were used in this study. Three T2 homozygous lines (ASD16-4-1-1, 5-1-1, and 6-1-1) were identified from seven putative (T0) transgenic lines expressing chi11 using Western blotting analysis. The inheritance of sheath blight resistance in those lines was studied over generations. The stability of chi11 expression up to T4 generation in all the three homozygous lines was proved by Western blot and the stability of sheath blight resistance in the homozygous lines was proved up to T4 generation using detached leaf and intact leaf sheath assays. Among the three homozygous lines tested, ASD16-4-1-1 showed consistent results in all the generations and gave a better protection against the sheath blight pathogen than the other two lines.

An overexpression of the AP2/ERF transcription factor from Iris typhifolia in Arabidopsis thaliana confers tolerance to salt stress

J. WU, J. ZHANG, X. LI, J. LIU, Z. NIU, L. WANG*

Biologia plantarum 63:776-784, 2019 | DOI: 10.32615/bp.2019.082

The roles of ethylene responsive factors (ERFs) and their positive and negative regulations of abiotic stress tolerance have been widely reported. This study reports the characterization of ItERF from Iris typhifolia Kitag with respect to molecular and functional properties. The 867 bp cDNA fragment of ItERF was cloned by reverse transcription PCR from I. typhifolia. Real-time quantitative PCR revealed that ItERF expression was induced in the roots, stems, and leaves of I. typhifolia after NaCl treatment, and that ItERF expressions were significantly higher in the leaves and roots than in the stems. A green fluorescent protein marker revealed that ItERF was located to the nucleus. Plant survival and root growth of ItERF transgenic Arabidopsis thaliana L. seedlings were much better than those of the wild type under NaCl stress. Malondialdehyde content in the transgenic lines was significantly lower than that in the wild type. Growth of yeast transformants showed an enhanced tolerance to salt stress than non-transformed yeast cells. All of the results verified that the expression of ItERF had effects on plant growth under salt stress.

Isolation and expression profiles of class III PRX gene family under drought stress in Camellia sinensis

H.J. LI, H.B. WANG, Y. CHEN, Q.P. MA, Z. ZHAO, X.H. LI, X. CHEN

Biologia plantarum 64:280-288, 2020 | DOI: 10.32615/bp.2019.120

The class III PRX family is a class of heme-containing oxidases and plays important roles in response to abiotic stress in plants. The responses to abiotic stresses could be regulated by phytohormones like abscisic acid (ABA) and methyl jasmonate (MeJA). In this research, 11 CsPRXs genes in tea plant (Camellia sinensis) were cloned and analyzed. Based on the similarity of the sequences, they were classified into 5 sub-groups. According to the results of reverse transcription PCR, CsPRX55 presented the highest expression in roots compared to stems and leaves of both tea cultivars LJ43 and Baiye 1. Besides, the expressions of CsPRX12 and CsPRX73 were highest in roots, while CsPRX4, CsPRX47, and CsPRX72 were highest in stems of 'Baiye 1'. But most of CsPRXs showed the highest expressions in leaves of 'LJ43'. CsPRXs appeared different expression patterns under drought stress of tea plants which were pre-treated with ABA or MeJA for three days. In 'LJ43' and 'Baiye 1', there were 3 CsPRXs and 7 CsPRXs up-regulated by exogenous ABA and MeJA, respectively. However, CsPRX4 and CsPRX16 were down-regulated in 'LJ43' treated with ABA and MeJA. It suggested that CsPRXs possessed diverse functions in response to hormones and abiotic stress. In 'LJ43', the activity of peroxidase (POD) was increased when pre-treated by ABA and MeJA, and the highest activity appeared after 24 and 12 h, respectively. In 'Baiye 1', the activity of POD was also increased, however, when pre-treated by MeJA, the peak-time of POD activity was at 24 h. But the change had no obvious rule after ABA treatment. Exogenous ABA or MeJA may play a role in protecting tea plants suffered from drought stress via regulating some CsPRXs expressions and increasing POD activity.

Mechanisms of drought resistance in introgression forms of Lolium multiflorum/Festuca arundinacea

D. PERLIKOWSKI, A. KOSMALA

Biologia plantarum 64:497-503, 2020 | DOI: 10.32615/bp.2020.076

Drought resistance in plants can be associated with four different strategies to cope with water stress. These strategies are classified as drought escape, avoidance, tolerance, and recovery. The expression of each strategy depends on plant species and its genetic potential, but also on the environmental conditions, including the stress intensity and duration. Often, prolonged drought conditions are associated with drought escape or avoidance, whereas short but severe drought periods induce drought tolerance. To analyze the components of drought resistance in forage grasses, we applied two Lolium multiflorum/Festuca arundinacea introgression forms into a comprehensive research. Obtained results clearly show that the response of plants to severe short term drought conditions with limited rhizosphere did not reflect their response to long progressive drought conditions, which did not limit root growth. The BC4-INT-40 introgression form with extensive and deep roots was characterized by a more efficient drought avoidance and regeneration mechanisms under long-term drought, whereas the BC4-INT-66 form with shorter roots revealed a lower productivity and re-growth capacity under the prolonged drought. On the other hand, this form had also a better photosynthetic performance under short and intensive drought conditions with a limited space for root development.

Identification and validation of organ-preferential genes and analysis of corresponding upstream tissue-specific promoters in wheat

P.P. Su, X. Jin, T. Sun, L. Chen, F. Shi, K.X. Li, J.L. Chang, G.X. Yang, G.Y. He

Biologia plantarum 63:78-88, 2019 | DOI: 10.32615/bp.2019.010

Tissue/organ-specific promoters are important tools in genetic engineering and crop molecular breeding. They are well characterized in dicots, such as Arabidopsis, tobacco, and tomato, but not sufficiently in monocots, especially in wheat. In this study, the genes specifically expressed in seven different tissues, including coleoptile, root, leaf, pistil, anther, embryo, and endosperm were identified through analyzing the public transcriptome data from a wheat microarray using the ROKU method. The expression patterns of selected genes were validated by reverse transcription polymerase chain reaction. The results showed that these selected genes were expressed specifically or preferentially in each representative tissue/organ. Moreover, the function of their promoters was verified by transient expression in wheat or stable transformation in Arabidopsis. The results showed that these promoters can efficiently and predominantly drive uidA (β-glucuronidase) reporter gene expression in different tissues. Due to their tissue-specific nature, these promoters can be used as potential candidates in plant genetic engineering.

Altered fatty acid composition of Nicotiana benthamiana and Nicotiana excelsior leaves under transient overexpression of the cyanobacterial desC gene

M. BERESTOVOY, O.S. PAVLENKO, A.A. TYURIN, E.N. GORSHKOVA, I.V. GOLDENKOVA-PAVLOVA

Biologia plantarum 64:167-177, 2020 | DOI: 10.32615/bp.2019.144

Transient heterologous gene expression in two model plant species, Nicotiana benthamiana and N. excelsior, has been used to study the localization of the heterologous Δ9 acyl-lipid desaturase (Δ9 desaturase) of Synechococcus vulcanus in different cell compartments and its functional activity in the cases of the cytosol, chloroplast, and endoplasmic reticulum (ER) localization. The functional activity and substrate specificity of the heterologous desaturase under the conditions of transient expression have been confirmed by comparison of fatty acid (FA) profiles. The Δ9 desaturase, responsible for the synthesis of oleic and palmitoleic acids, has also been shown to strongly promote the accumulation of polyunsaturated FAs. The results convincingly demonstrate that the Δ9 desaturase of the thermophilic cyanobacterium transiently expressed in two Nicotiana species considerably alters lipid metabolism in their leaves towards a higher FA unsaturation. The functional activity of Δ9 desaturase depends on both the model plant species, N. benthamiana or N. excelsior, and the cellular localization of the enzyme. The method of transient expression of heterologous genes in plants is highly effective, inexpensive, and not time-consuming, which makes it attractive for estimating the functional activity and/or substrate specificity of heterologous desaturases.

Leaf nutrient homeostasis and maintenance of photosynthesis integrity contribute to adaptation of the pea mutant SGECdt to cadmium

A.A. BELIMOV, I.C. DODD, V.I. SAFRONOVA, K.-J. DIETZ

Biologia plantarum 64:447-453, 2020 | DOI: 10.32615/bp.2020.061

Cadmium (Cd) is a highly toxic and widespread soil pollutant, which negatively affects various aspects of plant growth and physiology. Here, the role of photosynthesis in response to Cd was investigated in the Cd-tolerant pea (Pisum sativum L.) mutant SGECdt. The wild type SGE and the mutant SGECdt were grown in a hydroponic solution supplemented with 1, 3, or 4 µM CdCl2 for 12 d. Root and shoot biomasses of the Cd-treated SGECdt were significantly higher than of SGE. Cadmium had little effect on the quantum yield of photosystem II (φPSII) and chlorophyll content of intact leaves of both pea genotypes. However, when leaf slices were taken from Cd-exposed plants and incubated with high Cd concentrations, the SGECdt mutant showed 1.5 - 2 times higher φPSII values than SGE, with genotypic differences maximal at 0.1 and 1 mM CdCl2. In contrast, when leaf slices were taken from plants previously unexposed to Cd, both pea genotypes exhibited similar φPSII values. Cadmium content in leaves and mesophyll protoplasts of Cd-treated SGECdt were about 2 - 3 times higher than in SGE ones. The mutant leaves and mesophyll protoplasts had also higher Ca, Mg, Mn, and Zn content. Thus, SGECdt acclimated to Cd during growth in the Cd-supplemented nutrient solution by developing a molecular mechanism related to photosynthetic integrity. A higher foliar nutrient content likely allows enhanced photosynthesis by counteracting the damage of leaves caused by Cd.

Virus induced PhFTRv gene silencing results in yellow-green leaves and reduced cold tolerance in petunia

L. SANG, L. PENG, Z. QIU, F. LUO, G. CHEN, L. GAO, Y. YU, J. LIU

Biologia plantarum 64:807-813, 2020 | DOI: 10.32615/bp.2020.151

Ferredoxin-thioredoxin reductase (FTR) is an iron-sulfur protein that supplies electrons from photochemically reduced ferredoxin (Fd) to thioredoxin (Trx) in the ferredoxin/thioredoxin system in chloroplasts. The FTR is a heterodimer with a variable subunit (FTRv) and a catalytic subunit (FTRc). The function of FTRv is not well known. In petunia (Petunia hybrida), FTRv is a single-copy gene, which is named PhFTRv. In this study, the spatio-temporal expression of PhFTRv in petunia was analyzed, and PhFTRv transcription was found to be high in leaves and stems. A tobacco rattle virus gene silencing was used in this study. Virus induced gene silencing-mediated PhFTRv silencing resulted in large yellow-green leaves, delayed flowering, and reduced cold tolerance in petunia plants.

Translation initiation in plants: roles and implications beyond protein synthesis

S. Dutt, J. Parkash, R. Mehra, N. Sharma, B. Singh, P. Raigond, A. Joshi, S. Chopra, B. P. Singh

Biologia plantarum 59:401-412, 2015 | DOI: 10.1007/s10535-015-0517-y

Protein synthesis is a ubiquitous and essential process in all organisms, including plants. It is primarily regulated at translation initiation stage which is mediated through a number of translation initiation factors (eIFs). It is now becoming more apparent that in addition to synthesis of proteins, eIFs also regulate various aspects of plant development and their interaction with environment. Translation initiation factors, such as eIF3, eIF4A, eIF4E, eIF4G, and eIF5A affect different processes during vegetative and reproductive growth like embryogenesis, xylogenesis, flowering, sporogenesis, pollen germination, etc. On the contrary, eIF1A, eIF2, eIF4, and eIF5A are associated with interaction of plants with different abiotic stresses, such as high temperature, salinity, oxidative stress, etc. Similarly, eIF4E and eIF4G have roles in interaction with many viruses. Therefore, the translation initiation factors are important candidates for improving plant performance and adaptation. A large number of genes encoding eIFs can functionally be validated and utilized through genetic engineering approaches for better adaptability and performance of plants by inhibiting/minimizing or increasing expression of desired eIF(s).

Impacts of silicon and silicon nanoparticles on leaf ultrastructure and TaPIP1 and TaNIP2 gene expressions in heat stressed wheat seedlings

A.A. YOUNIS, H. KHATTAB, M.M. EMAM

Biologia plantarum 64:343-352, 2020 | DOI: 10.32615/bp.2020.030

Heat stress is one of the most crucial factors affecting crop growth and productivity worldwide. So, searching for a potent eco-friendly heat stress alleviator is the main issue nowadays. The current study was conducted to assess the ameliorative effects of 1.5 mM potassium silicate (K2SiO3, further only Si) or 1.66 mM silicon dioxide nanoparticles (SiNPs) on wheat (Triticum aestivum L.) seedlings exposed to heat stress (45 °C, 4 h). The observations show that Si or SiNPs treatments significantly restored the heat stress-provoked ultrastructural distortions of cellular organelles, particularly chloroplasts and the nucleus. Further, both Si and SiNPs enhanced the photosynthetic capacity as revealed by increments in the photochemical efficiency of photosystem II and the performance index as well as the content of photosynthetic pigments. A reduction in malondialdehyde accumulation in Si and SiNPs treated plants was positively related to their membrane stability index. The reverse transcription PCR analysis showed that Si treatment but not SiNP treatment stimulated the overexpressions of both Triticum aestivum plasma membrane intrinsic protein (TaPIP1) and Triticum aestivum nodulin 26-like intrinsic protein (TaNIP2) aquaporin genes parallelly with an improvement in the relative water content. This investigation reveals that Si was more effective than SiNPs in restoring the heat stress injuries. To the best of our knowledge, this is the first investigation exploring the effects of Si and SiNPs in improving thermotolerance of wheat seedlings.

Cloning and characterization of a UDP-glucose dehydrogenase gene from mulberry Broussonetia kazinoki × Broussonetia papyifera

R.H. JI, Z. ZHANG, X. GUO, Y.L. BAO, W.B. ZHANG, X.F. LIN, S.L. BAI

Biologia plantarum 64:667-678, 2020 | DOI: 10.32615/bp.2020.099

Uridine diphosphate glucose dehydrogenase (UGDH) is a key enzyme in the hemicellulose and pectin biosynthesis pathway and participates in the regulation of growth and development in plants. In this study, we isolated a BpUGDH gene from paper mulberry (Broussonetia kazinoki × Broussonetia papyifera) and analyzed its function and expression characteristics. The results show that the BpUGDH was expressed in all organs of paper mulberry with a higher expression in stems than in leaves and roots. A pBpUGDH::GUS gene construct was highly expressed in transgenic Arabidopsis thaliana seedlings, and its expression was induced by a low temperature, methyl jasmonate, gibberellin A3, ethylene, and auxin. The overexpression of BpUGDH increased the soluble sugar content, promoted the accumulation of hemicellulose, and enhanced the vegetative growth of transgenic plants. These results provide a basis for regulating the growth and adaptability of paper mulberry and improving its utilization value via genetic modification of the BpUGDH gene.

Differences in physiological traits at the initial stage of Fusarium head blight infection in wheat

V. SPANIC, Z. ZDUNIC, G. DREZNER, M. VILJEVAC VULETIC

Biologia plantarum 64:185-192, 2020 | DOI: 10.32615/bp.2020.014

Wheat (Triticum aestivum L.) is leading cereal crop worldwide, but its yield is highly affected due to various diseases, especially Fusarium head blight (FHB), which affects the metabolism of plants. The present study was conducted at the Agricultural Institute Osijek using three winter wheat cultivars (Apache, Bezostaya1, and U1) during 2016/2017. The objectives of our studies were to examine differences in physiological characteristics of FHB resistance among wheat cultivars in the early stage of infection. The FHB incidence and severity was the highest in 'Bezostaya1'. Results suggest that activation of some anti-oxidative enzymes in the first 2 h after Fusarium attack was not efficient to prevent disease. 'Apache', which revealed an average FHB incidence, efficiently activated defence response through phenol metabolism elevation. The most effective defence response trough activation of anti-oxidative enzymes triggered by H2O2 was revealed in 'U1', which resulted in a minimal FHB incidence and disease severity. The obtained results confirm differences in defence strategies of wheat genotypes.

The rice Aux/IAA transcription factor gene OsIAA18 enhances salt and osmotic tolerance in Arabidopsis

G. LI, Y.X. YE, X.Q. REN, M.Y. QI, H.Y. ZHAO, Q. ZHOU, X.H. CHEN, J. WANG, C.Y. YUAN, F.B. WANG

Biologia plantarum 64:454-464, 2020 | DOI: 10.32615/bp.2019.069

In plants, auxin/indoleacetic acid (Aux/IAA) proteins are transcriptional regulators, which regulate developmental process and responses to phytohormones and stress treatments. A previous study has shown that the rice Aux/IAA transcription factor gene OsIAA18 is induced by salt and osmotic stresses. However, little is known about the regulatory functions of this gene. In this study, the OsIAA18 gene was successfully cloned from rice. Subcellular localization analysis in onion epidermal cells indicated that OsIAA18 was localized to the nucleus. Expression analysis in yeast showed that the full length OsIAA18 exhibited transcriptional activation. Heterologous expression of OsIAA18 significantly enhanced salt and osmotic tolerance in transgenic Arabidopsis plants. Real-time quantitative PCR analysis showed that constitutive expression of OsIAA18 up-regulated genes involved in abscisic acid (ABA) biosynthesis, proline biosynthesis, stress responses, and reactive oxygen species scavenging under salt and osmotic stresses. Enzymatic analyses found that the transgenic plants had higher 9-cis-epoxycarotenoid dioxygenase, pyrroline-5-carboxylate synthase, superoxide dismutase, and peroxidase activities than wild-type plants under salt and osmotic stresses. In the transgenic plants, ABA and proline content significantly increased, whereas H2O2 and malondialdehyde content significantly decreased. In addition, the transgenic plants had also a lower electrolyte leakage and water loss rate. These overall results indicate that the OsIAA18 gene is involved in enhancing salt and osmotic tolerance in transgenic Arabidopsis plants. The OsIAA18 gene has a potential to be used to enhance the tolerance to abiotic stresses in other plant species.

Festulolium field performance under fluctuating growing conditions in Lithuania

V. KEMEŠYTĖ, K. JAŠKŪNĖ, G. STATKEVIČIŪTĖ

Biologia plantarum 64:821-827, 2020 | DOI: 10.32615/bp.2020.165

Festulolium cultivars are widely utilized in Lithuania because they are persistent under abiotic stresses and are high yielding. However, changing climate challenges the existing Festulolium cultivars to adapt to new growing conditions and still maintain the yield. In this study, we aimed at evaluating the yield stability of two Festulolium cultivars in field trials under fluctuating Lithuanian conditions. The mean total dry matter yield (DMY) of both Festulolium cultivars fluctuated greatly between the years and ANOVA analysis showed a significant effect of environment on total DMY as well as DMY of each cut, but the genotype × environment interaction was not significant. There was a high difference between the total DMY of 1st year and 2nd year of use of plots in each year of observation. The highest DMYs were harvested in the years 2015 and 2016. Dry matter yield of the 1st cut was the largest component of the total DMY for most of the years. The plants overwintered the first winter after sowing very well over the whole study period, resulting in excellent spring growth. The winter survival scores of 2nd year of use of plots were lower than 1st year of use and strongly correlated with the 1st cut DMY of 2nd year of use (r = 0.81). Spring growth of plants at 2nd year of use was poorer, the correlation between winter survival and spring growth of 2nd year of use was 0.62. The scores of regrowth after the cuts of 1st and 2nd years of use were very similar for most of the experimental years and moderately correlated with the sum of DMYs after cuts (r = 0.55 and r = 0.5, respectively).

Pyramiding insect and disease resistance in an elite indica rice cultivar ASD16

T. RAJESH, S. MARUTHASALAM, K. KALPANA, K. POOVANNAN, K.K. KUMAR, E. KOKILADEVI, D. SUDHAKAR, R. VELAZHAHAN, P. BALASUBRAMANIAN

Biologia plantarum 64:77-86, 2020 | DOI: 10.32615/bp.2019.106

Pyramiding transgenes of interest is one of the strategies to engineer multiple stress resistance in crop plants. Transgenic plants which stably express different genes can be hybridized to bring these genes together in one plant. Transgenic rice (Oryza sativa L. cv. ASD 16) plants harbouring genes Xa21 (conferring bacterial blight resistance), tlp (conferring resistance to sheath blight), or gna (conferring resistance to brown planthopper) were used in hybridization experiments. Sexual hybridization was carried out in two different gene combinations: Xa21 × gna and tlp × gna. Molecular analyses were carried out to confirm the presence of transgenes. In F1 generation, lines harbouring either gene in each of the cross-combination were selected and forwarded to F2 generation. The presence of genes in F2 generation was confirmed by PCR, Southern blot hybridization, and Western blotting. The F2 progeneis harbouring Xa21 and gna exhibited resistance against bacterial blight and moderate resistance against brown planthopper. Similarly, the F2 lines of tlp and gna combination provided resistance against sheath blight and moderate resistance against brown planthopper. The level of resistance observed in pyramided lines for insect or pathogens was comparable to the resistance observed in their parental lines. Our study shows that pyramiding genes by hybridization between transgenic plants could be one of the strategies to develop cultivars with multiple biotic stress resistances.

Mannose regulates water balance, leaf senescence, and genes related to stress tolerance in white clover under osmotic stress

S.Y. ZHAO, W.H. ZENG, Z. LI, Y. PENG

Biologia plantarum 64:406-416, 2020

Mannose (MAN), an important monosaccharide, contributes to coping with abiotic stresses in plants. Objectives of this study were to examine whether exogenous MAN (30 mM) could significantly increase drought tolerance and further to reveal MAN-regulated tolerance mechanism in white clover under osmotic stress induced by 18 % (m/v) polyethylene glycol 6000 for 10 d in controlled growth chambers. Results show that the application of MAN significanlty alleviated stress damage and the inhibition of growth and photosynthesis in white clover under osmotic stress. The MAN-induced increase in endogenous MAN content and the accumulation of organic osmolytes (proline and water soluble sugars) could be responsible for a lower osmotic potential (OP) in white clover. The exogenous application of MAN also enhanced antioxidant enzyme (superoxide dismutase, peroxidase, ascorbate peroxidase, dehydroascorbate reductase, and glutathione reductase) activities and maintained ascorbic acid content in white clover during osmotic stress. As concern chlorophyll (Chl) metabolism, the MAN-treated plants showed significantly higher transcription of genes involved in Chl synthesis Mg-chelatase and protochlorophyllide reductase and lower transcription of pheophorbide a oxygenase and chlorophyllase related to Chl degradation and also a senescence associated gene 101 than untreated plants. In addition, the MAN application increased transcription of SK2-, Y2K-, and Y2SK-type dehydrin genes, and dehydrin b in leaves of white clover under osmotic stress. These results indicate that MAN plays important roles in drought tolerance not only acting as a compatible solute for OP but also delaying leaf senescence through enhancing antioxidant metabolism, decreasing Chl degradation, and increasing transcription of dehydrin genes contributing to enhanced drought tolerance in white clover.

Spontaneous natural formation of interspecific hybrids within the Festuca-Lolium complex

B. BOLLER, J. HARPER, E. WILLNER, J. FUCHS, M. GLOMBIK, J. MAJKA, V. MAHELKA, C. ZHAO, D. KOPECKŨ

Biologia plantarum 64:679-691, 2020 | DOI: 10.32615/bp.2020.111

Interspecific and intergeneric hybridization within the Festuca-Lolium complex is frequently used in forage plant breeding. However, little is known about the natural occurrence and competitiveness of such hybrids. We collected naturally formed hybrids between Festuca apennina, Festuca pratensis, and Lolium perenne in different habitats of Switzerland and the British Isles and studied their origin, the ease of their spontaneous formation, and their competitiveness with parental species. A special attention was paid to the largely sterile triploid forms and their rare sexual progeny. The triploid hybrid F. apennina × F. pratensis proved to be widespread and often highly competitive in Swiss permanent pastures. The majority of these hybrids originated from F. apennina as the seed parent although little or no F. apennina grew nearby. In an experimental setting with ample F. pratensis pollen provided by neighbouring plants, up to 20 % of seeds from open pollinated F. apennina plants were interspecific hybrids; among seeds collected in natural habitats, only 0.35 % were hybrids. At an experimental site at 1 000 m altitude, these triploid hybrids grew much more vigorously than corresponding tetraploid pure F. apennina, confirming their great competitiveness at such altitudes in permanent grasslands. The triploid hybrids were only marginally fertile suggesting that vegetative propagation by rhizomes is the cause of their competitive success in grassland. Moreover, triploid progeny retained the chromosome constitution of their mother plants indicating the possibility of apomixis. Natural triploid F. pratensis × L. perenne hybrids were partially female fertile (a seed set of 0.1 % or less) whereas diploid hybrids did not produce any viable seeds. Progenies of these triploids showed considerable chromosome alterations, such as loss of a genome or recombination due to homoeologous pairing, and only rarely the chromosome constitution of the triploid mother plant was retained. It was concluded that natural triploid interspecific hybrids could expand the range of their progenitor species and might function as bridges transferring genes between them.

Silver nanoparticles with different concentrations and particle sizes affect the functional traits of wheat

S. WANG, B. D. WU, M. WEI, J. W. ZHOU, K. JIANG, C.Y. WANG

Biologia plantarum 64:1-8, 2020 | DOI: 10.32615/bp.2019.122

The response of functional traits of plants to external environment can influence their competitive ability because these functional traits are required for the acquisition of resources. The overuse of silver nanoparticles (AgNPs) has gained attention due to their environmental toxicity. This study aimed to examine the effects of AgNPs with different concentrations and particle sizes on functional traits of wheat. It was observed that AgNPs significantly reduced the plant height and so decrease its competitive ability. Ag ions decreased leaf chlorophyll and nitrogen content and specific leaf area more than AgNPs, but the opposite was true for leaf length, single leaf fresh mass, and shoot fresh mass. Hence, the toxicity of AgNPs may be higher than that of Ag ions in some cases. In this study, leaf chlorophyll and nitrogen content decreased with increasing concentration of AgNPs (with size 30 nm). The AgNPs with smaller particle size exerted higher toxicity on leaf chlorophyll and N content than those with larger particle size at the same concentration. However, AgNPs with larger particle size reduced more aboveground fresh mass than those with smaller particle size at the same concentration.

Effect of virus inducible cis-element insertion on transcription properties of improved GWSF promoter in Arabidopsis thaliana

Z.C. HUANG, H. LI

Biologia plantarum 64:320-323, 2020 | DOI: 10.32615/bp.2020.032

An ideal synthetic promoter can accurately regulate gene expression and the minimal cauliflower mosaic virus 35S promoter (GWSF) is an ideal synthetic pathogen-inducible promoter (SPIP) with several advantages. Three modified SPIPs, named as VGWSF, GWVSF, and GWSFV according to the arrangement of cis-elements, were optimized by inserting the dimer of a virus inducible cis-element (TTGGGAAGGAATTTCCTACT, V-box) upstream, midstream, or downstream the GWSF sequence. The three promoters were used to replace the cauliflower mosaic virus 35S promoter in the plasmid pBI121 in order to control the expression of the β-glucuronidase (gus) gene. Transformation of Arabidopsis thaliana (ecotype Col‑0) plants was performed via the Agrobacterium tumefaciens strain GV3101 by the floral dip method. The five-week-old transgenic T3 lines were histochemically stained for GUS activity to evaluate the transcriptional properties of modified SPIPs. The VGWSF and GWVSF had low basal expressions and could not be induced by low or high temperatures and a low osmotic potential but could be induced by the tobacco mosaic virus (TMV). Although GWSFV had the highest GUS activity, it showed a substantial basal expression. After being treated with TMV, abscisic acid (ABA), salicylic acid (SA), or ethylene (Eth) for12 h, the expressions of modified SPIPs were evaluated by real-time quantitative PCR. With the basal expression of GWSF as a reference, each treatment was represented as log2 (fold to the GWSF basal level). The basal expression of VGWSF and expressions induced by TMV, ABA, SA, and Eth were 1.39, 3.42, 6.01, 4.14, and 2.26, respectively, whereas the corresponding values of GWVSF were 1.16, 4.07, 3.72, 4.65, and 3.98, respectively, and the corresponding values of GWSFV were 4.43, 6.11, 4.83, 3.69, and 3.34, respectively. The results revealed that three modified SPIPs acquired virus induction activity due to the insertion of V-box. The V-box insertion position had a significant impact on transcription properties of modified SPIPs.

A rapid translocation of photoassimilates from source organs maintains grain yield in cowpea subjected to drought stress during grain filling

C. EGASHIRA, Y. HASHIGUCHI, E. KURAUCHI, Y. TATSUMI, A.C.S. NAKAGAWA, N. HAMAOKA, T. YUASA, M. IWAYA-INOUE, Y. ISHIBASHI

Biologia plantarum 64:529-534, 2020 | DOI: 10.32615/bp.2019.129

We examined the influence of drought stress during grain filling on grain yield to investigate changes in assimilates in sink and source organs. When plants were subjected to drought stress from the start of grain filling until harvest, the photosynthetic rate rapidly decreased. Grain dry mass during maturation was not significantly different between the control and drought-stressed plants. Under drought stress conditions, starch content in source organs (peduncle, leaf, petiole, stem, and root) was significantly lower than in corresponding organs of control plants; the greatest difference was seen in leaves. Consistent with this observation, α- and β-amylase activities in leaves significantly increased within the first 6 d of drought stress. We conclude that in cowpea subjected to drought stress during grain filling, the grain yield is maintained, despite a dramatic decrease in photosynthetic rate, by translocation of photoassimilates from source organs.

Characterization and functional analysis of microRNA399 in Cunninghamia lanceolata

F.R. ZHU, Z.B. QIU, Y.M. ZHANG, X. R. ZHANG, W. L.WANG

Biologia plantarum 64:193-199, 2020 | DOI: 10.32615/bp.2020.037

The miR399 is a conserved microRNA (miRNA) family, and it has been characterized as an essential regulator of phosphorus transport in plants. However, the biological function of miR399 in Cunninghamia lanceolata is still largely unclear. In this study, the comparison of mature miR399 sequence revealed a high similarity between Arabidopsis thaliana and C. lanceolate, and the pre-miR399 was capable of forming a typical stem-loop hairpin structure. A gene PHOSPHATE 2 (PHO2) was identified as a target of cln-miR399 using 5' rapid amplification of cDNA ends. Furthermore, the relationship between cln-miR399 and PHO2 was further confirmed through a transient co-expression of both genes in Nicotiana benthamiana. To examine the function of miR399 in Arabidopsis, miR399-overexpressing transgenic Arabidopsis thaliana was acquired using Agrobacterium-mediated approach. Real-time PCR showed that the amount of cln-MIR399 transcripts was higher in miR399-overexpressing plants than in wild-type plants, which was accompanied with down-regulation of expression of its target gene AtPHO2. The P content was 1.40 to 1.56-fold higher in the leaves of three transgenic lines than in wild type plants. However, the P content in the roots of the three transgenic lines was 24.5 - 37.2 % less than that in wild type plants. Moreover, the transcriptions of three phosphate transporter genes (PHT1, PHT2, and PHT3) were up-regulated in roots of miR399-overexpressing Arabidopsis plants. Interestingly, the transgenic lines exhibited retarded growth under normal P conditions compared with the wild type. Our findings demonstrate that cln-miR399 may play crucial roles in P transport and plant growth via regulation of its target gene PHO2.

Transcriptome analysis deciphers the mechanisms of exogenous nitric oxide action on the response of melon leaves to chilling stress

Q. DIAO, Y. CAO, H. FAN, Y. ZHANG

Biologia plantarum 64:465-472, 2020 | DOI: 10.32615/bp.2020.021

Chilling stress is a major abiotic factor that limits the growth and productivity of melon (Cucumis melo L.). The application of nitric oxide (NO) can enhance plant tolerance to chilling stress; however, the underlying molecular mechanisms for this process remain poorly understood. In this study, RNA sequencing was performed on melon seedlings exposed to control conditions, chilling stress, or chilling stress in the presence of NO donor sodium nitroprusside (SNP), to identify NO-mediated transcript changes in response to chilling stress. The results identified 488, 1 012, and 1 589 differentially expressed genes (DEGs) between plants in optimum conditions (CK) and chilling stress (CS) groups, plants in the CS and chilling stress + SNP (CN) groups, and those in CK and CN groups, respectively. Through gene ontology (GO) database and Kyoto encyclopedia of genes and genomes (KEGG) enrichment analyses, the DEGs were classified as predominantly involved in saccharide metabolism, biosynthesis of other secondary metabolites, lipid metabolism, amino-acid metabolism, and signal transduction pathways. In addition, 39 genes related to sugar metabolism including those encoding UDP-glucuronate-4-epimerase, β-glucosidase, glucuronosyltransferase, α-1,4-galacturonosyl transferase, and hexokinase, were upregulated in the CK vs. CS comparison, and genes encoding fructose-bisphosphate aldolase and glucan-endo-1,3-β-glucosidase were upregulated in the CS vs. CN, and CK vs. CN comparisons. A gene encoding an EREBP-like factor was upregulated in the CK vs. CS, CS vs. CN, and CK vs. CN comparisons. The expression profiles of 10 selected genes were analyzed using real-time quantitative PCR, and the candidate gene expression patterns were consistent with the DEG classification from RNA-seq. Overall, the data provide insight into the transcriptional regulation by exogenous NO in the response of melon seedlings to chilling stress. The data from this study are relevant for further research on the molecular mechanisms that underlie chilling resistance in melon plants.

Di-n-butyl phthalate-induced phytotoxicity in Hordeum vulgare seedlings and subsequent antioxidant defense response

A. KUMARI, R. KAUR

Biologia plantarum 64:110-118, 2020 | DOI: 10.32615/bp.2019.095

Di-n-butyl phthalate (DBP) is one of the frequently detected phthalates in environmental samples. The effects of phthalates are extensively studied in the animals but the effects on plants are scarce. Therefore, the present study is aimed to envisage the effects of DBP on the antioxidative defense system in Hordeum vulgare L. seedlings grown under laboratory conditions for 7 d. The activities of different antioxidative enzymes were enhanced in the shoots. In the roots, the activity of guaiacol peroxidase increased and the catalase activity decreased initially but increased at higher DBP concentrations, whereas the activities of superoxide dismutase, ascorbate peroxidase, and glutathione reductase declined. Furthermore, the content of polyphenols elevated after exposure of seedlings to DBP. The possible reason for these responses of barley seedlings is the oxidative burst, i.e., enhanced production of reactive oxygen species, which were confirmed using confocal microscopy in terms of loss in plasma membrane integrity. DBP also disturbed the normal stomatal morphology of barley seedlings. The study may help to provide insights into the defense of crop plants against phthalate stress.

An HD-Zip IV transcription factor protein NbGL3 regulates glandular trichome initiation in tobacco

Y.S. TIAN, T.W. DAI, C.X. FAN, J. ZHOU, X.L. REN, Y. XU

Biologia plantarum 64:378-384, 2020 | DOI: 10.32615/bp.2020.012

Glandular trichomes, a specialized multicellular structure, are considered as biofactories due to their capability to synthesize and secrete a large amount of secondary metabolites. Tobacco leaves have a high density of glandular trichomes that produce huge amounts of secondary metabolites, which can be used as important industrial raw materials. However, molecular mechanism controling glandular trichome development in tobacco still remains largely unknown. In the present study, we found that NbGL3, an HD-Zip IV family gene from Nicotiana benthamiana, was highly expressed in mature leaves, and ethylene or auxin application could increase the expression of NbGL3. Virus induced gene silencing NbGL3 resulted in a decreased glandular trichome density on leaves. Putative downstream genes, such as micro trichome, cyclin B2, and wax inducer 1 like were down regulated in NbGL3 silenced plants. Our results demonstrate that NbGL3 could positively regulate initiation of glandular trichomes in tobacco.

Transcriptome-sequencing analyses reveal flower color formation in Strelitzia reginae

R.H. FAN, B. LIN, N.Y. FANG, X.X. YE, M.L. HUANG, H.Q. ZHONG

Biologia plantarum 64:717-724, 2020 | DOI: 10.32615/bp.2020.102

Strelitzia reginae is a popular cut flower that has blue petals and orange sepals. Flower color is an important plant trait; however, little is known about its molecular mechanisms in S. reginae. In this study, cDNA libraries were constructed for blue petals and orange sepals of S. reginae. A total of 75 487 unigenes were obtained from transcriptome sequencing and de novo assembly, of which 41.86 % were annotated by public databases. Ultra-high performance liquid chromatography analysis revealed that anthocyanins were the main pigment in blue petals, and that carotenoids controled pigment formation in the orange sepals. Using a system analysis-based approach, 73 and 29 candidate genes related to anthocyanin and carotenoid biosyntheses were identified, respectively. Among these, chalcone synthase 2, chalcone isomerase 1, flavanone 3-hydroxylase 1, flavonoid 3',5'-hydroxylase 1, dihydroflavonol 4-reductase 1, anthocyanidin synthase 1, and anthocyanidin 3-O-glucosyltransferase 1 were considered to be important in regulating the formation of blue petals, and phytoene synthase 1, phytoene desaturaser 1, ζ-carotene desaturase 1, lycopene β-cyclase 3, and β-carotene hydroxylase 2 might play important roles in orange sepal formation. This study improves our understanding of flower color and provides evidence for future molecular breeding of ornamental plants based on flower color modifications.

Biochemical and morphophysiological strategies of Myracrodruon

L.M. SOUZA, M.R. BARBOSA, M.B. MORAIS, L. PALHARES NETO, C. ULISSES, and T.R. CAMARA

Biologia plantarum 64:20-31, 2020 | DOI: 10.32615/bp.2019.070

In view of the ecological, social, and economic importance of Myracrodruon urundeuva Allemão, the objective of this study was to investigate the strategies of this species under drought during its initial phase of development. Two-month-old plants were cultivated under continuous irrigation or no irrigation for 20 d. After this period, the water-stressed plants were rehydrated for 20 d. Physiological, biochemical, and anatomical variables were evaluated on 20th and 40th day. Water deficit (25 and 85 % leaf relative content) caused senescence followed by leaf abscission. Growth in height was negatively affected by water deficit (37 % reduction). A decrease in the thickness of the mesophyll was accompanied by a decrease of the total chlorophyll content. Water deficit affected saccharide metabolism and altered cellular component dynamics. Enzyme activities were higher during the rehydration period than during the water stress. There was no increase in lipid peroxidation in plants subjected to water deficit. A reduction in the stomatal opening during water stress was a strategy of reducing water loss through transpiration.

Changes of cytosine methylation in pecan tissues of different stages by quantitative methylation-sensitive amplified polymorphism

Z.Z. LIU, F. ZHOU, J. SHANG, F.R. PENG, Z.H. MO, Y.R. LI

Biologia plantarum 64:473-484, 2020 | DOI: 10.32615/bp.2020.066

Cytosine methylation plays an important role in plant development by regulating gene expressions. However, few studies have investigated methylation changes during the tissue differentiation and development of perennial plants. Here, the fluorescence-labeled methylation-sensitive amplified polymorphism method was used with eight primer combinations to detect methylation in leaves and xylem obtained at the stages of inflorescence emergence (IE), ovary start growth, and fruit maturity (FM) in two pecan (Carya illinoinensis) cvs. Pawnee and Stuart. The results show that the total methylation in the xylem was generally higher than in the leaves at each stage. Substantial methylation variations were observed at the amplified sites in pecan tissues at the various stages. The methylation patterns changed between the leaf and xylem, with frequencies from 44.97 to 67.01 % over the three stages in the two cultivars, among which the variation frequency between the tissues at the FM stage was the highest for each cultivar. The frequencies of methylation variation between the leaf samples at any two stages ranged from 31.86 to 45.88 %, with higher variation frequencies between the xylem samples (40.90 - 59.44 %) for each cultivar, which is consistent with the comparative results of polymorphism rates between the leaf and xylem over the three stages. Cluster analysis and principal coordinate analysis suggest that the xylem at the IE and FM stages had relatively distant epigenetic relationships with other tissue samples as a whole. This study reveals the patterns of methylation variation and methylation relationships among pecan tissues undergoing different developmental processes, implying the important roles of methylation in tissue differentiation and development of trees. These results lay a theoretical foundation for elucidating the regulatory mechanisms of methylation involved in tree development.

 previous    1   2   3   4   5   6  7   8   9   10   11   ...    next