Wheat (Triticum aestivum L.) is leading cereal crop worldwide, but its yield is highly affected due to various diseases, especially Fusarium head blight (FHB), which affects the metabolism of plants. The present study was conducted at the Agricultural Institute Osijek using three winter wheat cultivars (Apache, Bezostaya1, and U1) during 2016/2017. The objectives of our studies were to examine differences in physiological characteristics of FHB resistance among wheat cultivars in the early stage of infection. The FHB incidence and severity was the highest in 'Bezostaya1'. Results suggest that activation of some anti-oxidative enzymes in the first 2 h after Fusarium attack was not efficient to prevent disease. 'Apache', which revealed an average FHB incidence, efficiently activated defence response through phenol metabolism elevation. The most effective defence response trough activation of anti-oxidative enzymes triggered by H₂O₂ was revealed in 'U1', which resulted in a minimal FHB incidence and disease severity. The obtained results confirm differences in defence strategies of wheat genotypes.

In plants, auxin/indoleacetic acid (Aux/IAA) proteins are transcriptional regulators, which regulate developmental process and responses to phytohormones and stress treatments. A previous study has shown that the rice Aux/IAA transcription factor gene OsIAA18 is induced by salt and osmotic stresses. However, little is known about the regulatory functions of this gene. In this study, the OsIAA18 gene was successfully cloned from rice. Subcellular localization analysis in onion epidermal cells indicated that OsIAA18 was localized to the nucleus. Expression analysis in yeast showed that the full length OsIAA18 exhibited transcriptional activation. Heterologous expression of OsIAA18 significantly enhanced salt and osmotic tolerance in transgenic Arabidopsis plants. Real-time quantitative PCR analysis showed that constitutive expression of OsIAA18 up-regulated genes involved in abscisic acid (ABA) biosynthesis, proline biosynthesis, stress responses, and reactive oxygen species scavenging under salt and osmotic stresses. Enzymatic analyses found that the transgenic plants had higher 9-cis-epoxycarotenoid dioxygenase, pyrroline-5-carboxylate synthase, superoxide dismutase, and peroxidase activities than wild-type plants under salt and osmotic stresses. In the transgenic plants, ABA and proline content significantly increased, whereas H₂O₂ and malondialdehyde content significantly decreased. In addition, the transgenic plants had also a lower electrolyte leakage and water loss rate. These overall results indicate that the OsIAA18 gene is involved in enhancing salt and osmotic tolerance in transgenic Arabidopsis plants. The OsIAA18 gene has a potential to be used to enhance the tolerance to abiotic stresses in other plant species.

Festulolium cultivars are widely utilized in Lithuania because they are persistent under abiotic stresses and are high yielding. However, changing climate challenges the existing Festulolium cultivars to adapt to new growing conditions and still maintain the yield. In this study, we aimed at evaluating the yield stability of two Festulolium cultivars in field trials under fluctuating Lithuanian conditions. The mean total dry matter yield (DMY) of both Festulolium cultivars fluctuated greatly between the years and ANOVA analysis showed a significant effect of environment on total DMY as well as DMY of each cut, but the genotype × environment interaction was not significant. There was a high difference between the total DMY of 1^st year and 2^nd year of use of plots in each year of observation. The highest DMYs were harvested in the years 2015 and 2016. Dry matter yield of the 1^st cut was the largest component of the total DMY for most of the years. The plants overwintered the first winter after sowing very well over the whole study period, resulting in excellent spring growth. The winter survival scores of 2^nd year of use of plots were lower than 1^st year of use and strongly correlated with the 1^st cut DMY of 2^nd year of use (r = 0.81). Spring growth of plants at 2^nd year of use was poorer, the correlation between winter survival and spring growth of 2^nd year of use was 0.62. The scores of regrowth after the cuts of 1^st and 2^nd years of use were very similar for most of the experimental years and moderately correlated with the sum of DMYs after cuts (r = 0.55 and r = 0.5, respectively).

Pyramiding transgenes of interest is one of the strategies to engineer multiple stress resistance in crop plants. Transgenic plants which stably express different genes can be hybridized to bring these genes together in one plant. Transgenic rice (Oryza sativa L. cv. ASD 16) plants harbouring genes Xa21 (conferring bacterial blight resistance), tlp (conferring resistance to sheath blight), or gna (conferring resistance to brown planthopper) were used in hybridization experiments. Sexual hybridization was carried out in two different gene combinations: Xa21 × gna and tlp × gna. Molecular analyses were carried out to confirm the presence of transgenes. In F₁ generation, lines harbouring either gene in each of the cross-combination were selected and forwarded to F₂ generation. The presence of genes in F₂ generation was confirmed by PCR, Southern blot hybridization, and Western blotting. The F₂ progeneis harbouring Xa21 and gna exhibited resistance against bacterial blight and moderate resistance against brown planthopper. Similarly, the F₂ lines of tlp and gna combination provided resistance against sheath blight and moderate resistance against brown planthopper. The level of resistance observed in pyramided lines for insect or pathogens was comparable to the resistance observed in their parental lines. Our study shows that pyramiding genes by hybridization between transgenic plants could be one of the strategies to develop cultivars with multiple biotic stress resistances.

Mannose (MAN), an important monosaccharide, contributes to coping with abiotic stresses in plants. Objectives of this study were to examine whether exogenous MAN (30 mM) could significantly increase drought tolerance and further to reveal MAN-regulated tolerance mechanism in white clover under osmotic stress induced by 18 % (m/v) polyethylene glycol 6000 for 10 d in controlled growth chambers. Results show that the application of MAN significanlty alleviated stress damage and the inhibition of growth and photosynthesis in white clover under osmotic stress. The MAN-induced increase in endogenous MAN content and the accumulation of organic osmolytes (proline and water soluble sugars) could be responsible for a lower osmotic potential (OP) in white clover. The exogenous application of MAN also enhanced antioxidant enzyme (superoxide dismutase, peroxidase, ascorbate peroxidase, dehydroascorbate reductase, and glutathione reductase) activities and maintained ascorbic acid content in white clover during osmotic stress. As concern chlorophyll (Chl) metabolism, the MAN-treated plants showed significantly higher transcription of genes involved in Chl synthesis Mg-chelatase and protochlorophyllide reductase and lower transcription of pheophorbide a oxygenase and chlorophyllase related to Chl degradation and also a senescence associated gene 101 than untreated plants. In addition, the MAN application increased transcription of SK2-, Y2K-, and Y2SK-type dehydrin genes, and dehydrin b in leaves of white clover under osmotic stress. These results indicate that MAN plays important roles in drought tolerance not only acting as a compatible solute for OP but also delaying leaf senescence through enhancing antioxidant metabolism, decreasing Chl degradation, and increasing transcription of dehydrin genes contributing to enhanced drought tolerance in white clover.

Interspecific and intergeneric hybridization within the Festuca-Lolium complex is frequently used in forage plant breeding. However, little is known about the natural occurrence and competitiveness of such hybrids. We collected naturally formed hybrids between Festuca apennina, Festuca pratensis, and Lolium perenne in different habitats of Switzerland and the British Isles and studied their origin, the ease of their spontaneous formation, and their competitiveness with parental species. A special attention was paid to the largely sterile triploid forms and their rare sexual progeny. The triploid hybrid F. apennina × F. pratensis proved to be widespread and often highly competitive in Swiss permanent pastures. The majority of these hybrids originated from F. apennina as the seed parent although little or no F. apennina grew nearby. In an experimental setting with ample F. pratensis pollen provided by neighbouring plants, up to 20 % of seeds from open pollinated F. apennina plants were interspecific hybrids; among seeds collected in natural habitats, only 0.35 % were hybrids. At an experimental site at 1 000 m altitude, these triploid hybrids grew much more vigorously than corresponding tetraploid pure F. apennina, confirming their great competitiveness at such altitudes in permanent grasslands. The triploid hybrids were only marginally fertile suggesting that vegetative propagation by rhizomes is the cause of their competitive success in grassland. Moreover, triploid progeny retained the chromosome constitution of their mother plants indicating the possibility of apomixis. Natural triploid F. pratensis × L. perenne hybrids were partially female fertile (a seed set of 0.1 % or less) whereas diploid hybrids did not produce any viable seeds. Progenies of these triploids showed considerable chromosome alterations, such as loss of a genome or recombination due to homoeologous pairing, and only rarely the chromosome constitution of the triploid mother plant was retained. It was concluded that natural triploid interspecific hybrids could expand the range of their progenitor species and might function as bridges transferring genes between them.

The response of functional traits of plants to external environment can influence their competitive ability because these functional traits are required for the acquisition of resources. The overuse of silver nanoparticles (AgNPs) has gained attention due to their environmental toxicity. This study aimed to examine the effects of AgNPs with different concentrations and particle sizes on functional traits of wheat. It was observed that AgNPs significantly reduced the plant height and so decrease its competitive ability. Ag ions decreased leaf chlorophyll and nitrogen content and specific leaf area more than AgNPs, but the opposite was true for leaf length, single leaf fresh mass, and shoot fresh mass. Hence, the toxicity of AgNPs may be higher than that of Ag ions in some cases. In this study, leaf chlorophyll and nitrogen content decreased with increasing concentration of AgNPs (with size 30 nm). The AgNPs with smaller particle size exerted higher toxicity on leaf chlorophyll and N content than those with larger particle size at the same concentration. However, AgNPs with larger particle size reduced more aboveground fresh mass than those with smaller particle size at the same concentration.

An ideal synthetic promoter can accurately regulate gene expression and the minimal cauliflower mosaic virus 35S promoter (GWSF) is an ideal synthetic pathogen-inducible promoter (SPIP) with several advantages. Three modified SPIPs, named as VGWSF, GWVSF, and GWSFV according to the arrangement of cis-elements, were optimized by inserting the dimer of a virus inducible cis-element (TTGGGAAGGAATTTCCTACT, V-box) upstream, midstream, or downstream the GWSF sequence. The three promoters were used to replace the cauliflower mosaic virus 35S promoter in the plasmid pBI121 in order to control the expression of the β-glucuronidase (gus) gene. Transformation of Arabidopsis thaliana (ecotype Col‑0) plants was performed via the Agrobacterium tumefaciens strain GV3101 by the floral dip method. The five-week-old transgenic T₃ lines were histochemically stained for GUS activity to evaluate the transcriptional properties of modified SPIPs. The VGWSF and GWVSF had low basal expressions and could not be induced by low or high temperatures and a low osmotic potential but could be induced by the tobacco mosaic virus (TMV). Although GWSFV had the highest GUS activity, it showed a substantial basal expression. After being treated with TMV, abscisic acid (ABA), salicylic acid (SA), or ethylene (Eth) for12 h, the expressions of modified SPIPs were evaluated by real-time quantitative PCR. With the basal expression of GWSF as a reference, each treatment was represented as log₂ (fold to the GWSF basal level). The basal expression of VGWSF and expressions induced by TMV, ABA, SA, and Eth were 1.39, 3.42, 6.01, 4.14, and 2.26, respectively, whereas the corresponding values of GWVSF were 1.16, 4.07, 3.72, 4.65, and 3.98, respectively, and the corresponding values of GWSFV were 4.43, 6.11, 4.83, 3.69, and 3.34, respectively. The results revealed that three modified SPIPs acquired virus induction activity due to the insertion of V-box. The V-box insertion position had a significant impact on transcription properties of modified SPIPs.

We examined the influence of drought stress during grain filling on grain yield to investigate changes in assimilates in sink and source organs. When plants were subjected to drought stress from the start of grain filling until harvest, the photosynthetic rate rapidly decreased. Grain dry mass during maturation was not significantly different between the control and drought-stressed plants. Under drought stress conditions, starch content in source organs (peduncle, leaf, petiole, stem, and root) was significantly lower than in corresponding organs of control plants; the greatest difference was seen in leaves. Consistent with this observation, α- and β-amylase activities in leaves significantly increased within the first 6 d of drought stress. We conclude that in cowpea subjected to drought stress during grain filling, the grain yield is maintained, despite a dramatic decrease in photosynthetic rate, by translocation of photoassimilates from source organs.

The miR399 is a conserved microRNA (miRNA) family, and it has been characterized as an essential regulator of phosphorus transport in plants. However, the biological function of miR399 in Cunninghamia lanceolata is still largely unclear. In this study, the comparison of mature miR399 sequence revealed a high similarity between Arabidopsis thaliana and C. lanceolate, and the pre-miR399 was capable of forming a typical stem-loop hairpin structure. A gene PHOSPHATE 2 (PHO2) was identified as a target of cln-miR399 using 5' rapid amplification of cDNA ends. Furthermore, the relationship between cln-miR399 and PHO2 was further confirmed through a transient co-expression of both genes in Nicotiana benthamiana. To examine the function of miR399 in Arabidopsis, miR399-overexpressing transgenic Arabidopsis thaliana was acquired using Agrobacterium-mediated approach. Real-time PCR showed that the amount of cln-MIR399 transcripts was higher in miR399-overexpressing plants than in wild-type plants, which was accompanied with down-regulation of expression of its target gene AtPHO2. The P content was 1.40 to 1.56-fold higher in the leaves of three transgenic lines than in wild type plants. However, the P content in the roots of the three transgenic lines was 24.5 - 37.2 % less than that in wild type plants. Moreover, the transcriptions of three phosphate transporter genes (PHT1, PHT2, and PHT3) were up-regulated in roots of miR399-overexpressing Arabidopsis plants. Interestingly, the transgenic lines exhibited retarded growth under normal P conditions compared with the wild type. Our findings demonstrate that cln-miR399 may play crucial roles in P transport and plant growth via regulation of its target gene PHO2.

Chilling stress is a major abiotic factor that limits the growth and productivity of melon (Cucumis melo L.). The application of nitric oxide (NO) can enhance plant tolerance to chilling stress; however, the underlying molecular mechanisms for this process remain poorly understood. In this study, RNA sequencing was performed on melon seedlings exposed to control conditions, chilling stress, or chilling stress in the presence of NO donor sodium nitroprusside (SNP), to identify NO-mediated transcript changes in response to chilling stress. The results identified 488, 1 012, and 1 589 differentially expressed genes (DEGs) between plants in optimum conditions (CK) and chilling stress (CS) groups, plants in the CS and chilling stress + SNP (CN) groups, and those in CK and CN groups, respectively. Through gene ontology (GO) database and Kyoto encyclopedia of genes and genomes (KEGG) enrichment analyses, the DEGs were classified as predominantly involved in saccharide metabolism, biosynthesis of other secondary metabolites, lipid metabolism, amino-acid metabolism, and signal transduction pathways. In addition, 39 genes related to sugar metabolism including those encoding UDP-glucuronate-4-epimerase, β-glucosidase, glucuronosyltransferase, α-1,4-galacturonosyl transferase, and hexokinase, were upregulated in the CK vs. CS comparison, and genes encoding fructose-bisphosphate aldolase and glucan-endo-1,3-β-glucosidase were upregulated in the CS vs. CN, and CK vs. CN comparisons. A gene encoding an EREBP-like factor was upregulated in the CK vs. CS, CS vs. CN, and CK vs. CN comparisons. The expression profiles of 10 selected genes were analyzed using real-time quantitative PCR, and the candidate gene expression patterns were consistent with the DEG classification from RNA-seq. Overall, the data provide insight into the transcriptional regulation by exogenous NO in the response of melon seedlings to chilling stress. The data from this study are relevant for further research on the molecular mechanisms that underlie chilling resistance in melon plants.

Di-n-butyl phthalate (DBP) is one of the frequently detected phthalates in environmental samples. The effects of phthalates are extensively studied in the animals but the effects on plants are scarce. Therefore, the present study is aimed to envisage the effects of DBP on the antioxidative defense system in Hordeum vulgare L. seedlings grown under laboratory conditions for 7 d. The activities of different antioxidative enzymes were enhanced in the shoots. In the roots, the activity of guaiacol peroxidase increased and the catalase activity decreased initially but increased at higher DBP concentrations, whereas the activities of superoxide dismutase, ascorbate peroxidase, and glutathione reductase declined. Furthermore, the content of polyphenols elevated after exposure of seedlings to DBP. The possible reason for these responses of barley seedlings is the oxidative burst, i.e., enhanced production of reactive oxygen species, which were confirmed using confocal microscopy in terms of loss in plasma membrane integrity. DBP also disturbed the normal stomatal morphology of barley seedlings. The study may help to provide insights into the defense of crop plants against phthalate stress.

Glandular trichomes, a specialized multicellular structure, are considered as biofactories due to their capability to synthesize and secrete a large amount of secondary metabolites. Tobacco leaves have a high density of glandular trichomes that produce huge amounts of secondary metabolites, which can be used as important industrial raw materials. However, molecular mechanism controling glandular trichome development in tobacco still remains largely unknown. In the present study, we found that NbGL3, an HD-Zip IV family gene from Nicotiana benthamiana, was highly expressed in mature leaves, and ethylene or auxin application could increase the expression of NbGL3. Virus induced gene silencing NbGL3 resulted in a decreased glandular trichome density on leaves. Putative downstream genes, such as micro trichome, cyclin B2, and wax inducer 1 like were down regulated in NbGL3 silenced plants. Our results demonstrate that NbGL3 could positively regulate initiation of glandular trichomes in tobacco.

Strelitzia reginae is a popular cut flower that has blue petals and orange sepals. Flower color is an important plant trait; however, little is known about its molecular mechanisms in S. reginae. In this study, cDNA libraries were constructed for blue petals and orange sepals of S. reginae. A total of 75 487 unigenes were obtained from transcriptome sequencing and de novo assembly, of which 41.86 % were annotated by public databases. Ultra-high performance liquid chromatography analysis revealed that anthocyanins were the main pigment in blue petals, and that carotenoids controled pigment formation in the orange sepals. Using a system analysis-based approach, 73 and 29 candidate genes related to anthocyanin and carotenoid biosyntheses were identified, respectively. Among these, chalcone synthase 2, chalcone isomerase 1, flavanone 3-hydroxylase 1, flavonoid 3',5'-hydroxylase 1, dihydroflavonol 4-reductase 1, anthocyanidin synthase 1, and anthocyanidin 3-O-glucosyltransferase 1 were considered to be important in regulating the formation of blue petals, and phytoene synthase 1, phytoene desaturaser 1, ζ-carotene desaturase 1, lycopene β-cyclase 3, and β-carotene hydroxylase 2 might play important roles in orange sepal formation. This study improves our understanding of flower color and provides evidence for future molecular breeding of ornamental plants based on flower color modifications.

The responses of antioxidant enzymes (AOE) ascorbate peroxidase (APX), glutathione reductase (GR), superoxide dismutase (SOD), and catalase (CAT) in soluble protein extracts from leaves and roots of tobacco (Nicotiana tabacum L. cv. Samsun NN) plants to the drought stress, salinity and enhanced zinc concentration were investigated. The studied tobacco included wild-type (WT) and transgenic plants (AtCKX2) harbouring the cytokinin oxidase/dehydrogenase gene under control of 35S promoter from Arabidopsis thaliana (AtCKX2). The transgenic plants exhibited highly enhanced CKX activity and decreased contents of cytokinins and abscisic acid in both leaves and roots, altered phenotype, retarded growth, and postponed senescence onset. Under control conditions, the AtCKX2 plants exhibited noticeably higher activity of GR in leaves and APX and SOD in roots. CAT activity in leaves always decreased upon stresses in WT while increased in AtCKX2 plants. On the contrary, the SOD activity was enhanced in WT but declined in AtCKX2 leaves. In roots, the APX activity prevailingly increased in WT while mainly decreased in AtCKX2 in response to the stresses. Both WT and AtCKX2 leaves as well as roots exhibited elevated abscisic acid content and increased CKX activity under all stresses while endogenous CKs and IAA contents were not much affected by stress treatments in either WT or transgenic plants.

Germin and germin-like proteins (GLPs) are a broad and diverse family of developmentally regulated proteins widely distributed in plants. Oryza sativa L. harbours a large family of GLPs and serves as a good model for their study. In the present study, a germin-like protein gene (OsRGLP1) of rice origin was characterized by its heterologous expression in tobacco. The real-time PCR established almost a uniform expression of OsRGLP1 in leaves, stem, and roots of T₁ Nicotiana tabacum cv. Samsun. Although no morphological difference was apparent between T₀ transgenic and wild-type plants, leaves of mature transgenic plants showed necrotic lesions associated with an elevated content of H₂O₂, which was evidenced by in situ 3,3'-diaminobenzidine staining. A significantly higher activity of heat resistant superoxide dismutase (SOD) was observed in the transgenic plants as compared to the wild-type. The SOD activity in the transgenic plants was insensitive to potassium cyanide and sensitive to H₂O₂.

A new member of the APETALA2/ethylene responsive element binding protein (AP2/EREBP) transcription factor family, HhDREB2, was isolated from Halimodendron halodendron. Based on the similarity of the AP2/ERF domain, HhDREB2 was classified into A-5 group of the DREB subfamily. The expression of HhDREB2 gene was induced by drought, high salinity, and low temperature, but not by exogenous plant hormones. Trans-activity assay demonstrated that HhDREB2 gene encodes a transcription activator. Furthermore, over-expression of HhDREB2 gene under the stress-inducible rd29A promotor in Arabidopsis resulted in enhanced tolerance to salt and drought stresses. The overall results reveal that HhDREB2 functioned as important transcription factor in regulation of stress-responsive signaling in plants and may be used for improving plant tolerance to abiotic stresses.

MAT (multi-auto-transformation) vector system has been one of the strategies to excise the selection marker gene from transgenic plants. Agrobacterium tumefaciens strain EHA105 harboring an ipt-type MAT vector, pNPI132, was used to produce morphologically normal transgenic Petunia hybrida 'Dainty Lady' employing isopentenyl transferase (ipt) gene as the selection marker gene. β-glucuronidase (GUS) gene was used as model gene of interest. Infected explants were cultured on Murashige and Skoog (MS) medium without plant growth regulators (PGR) and antibiotics. Shoots showing extreme shooty phenotype (ESP) were produced from the adventitious shoots separated from the explants. Visual selection was carried out until production of morphologically normal shoots (approximately 4 months after infection). Histochemical GUS assay detected GUS gene in both ESP and normal shoots. PCR analysis confirmed the presence of model gene (GUS gene) and excision of the selection marker (ipt) gene in the normal transgenic plants. The insertion sites (1-3 for ipt gene and 1-2 for GUS gene) were detected by Southern blot analysis using DIG-labeled probes of both genes. These results show that ipt-type MAT vector can be used successfully to produce marker-free transgenic Petunia hybrida plants on PGR- and antibiotic-free MS medium.

The halophyte Thellungiella salsuginea is a new model plants due to its small genome size, short life cycle, and copious seed production. Although T. salsuginea shares a high sequence identity with its close relative Arabidopsis thaliana, it shows a greater tolerance to salinity, drought, freezing, heat, and cold. To elucidate the mechanism of abiotic stress resistance in T. salsuginea, we characterized its cytosolic Apx1 gene (TsApx1) and established A. thaliana transgenic lines overexpressing TsApx1. Under 300 mM NaCl, the content of H₂O₂, malondialdehyde, and proline were lower and the activities of superoxide dismutase, catalase, glutathione peroxidase, and ascorbate peroxidase were all higher in the transgenic plants overexpressing TsApx1 (35S:TsApx1-GFP) than in the wild-type plants. The atapx1 mutant plants of A. thaliana had a NaCl/mannitol-sensitive phenotype. The ectopic expression of TsApx1 in the atapx1 mutant effectively remedied the phenotype. These results suggest that TsApx1 plays an important role in scavenging reactive oxygen species in the cytoplasm under salinity or drought. Although TsApx1 in T. salsuginea was constantly expressed at a high level, this gene was clearly inducible. In summary, the high constitutive expression and rapid induction of TsApx1 may contribute to the tolerance to abiotic stresses in T. salsuginea.

In plant cells, anion channels and transporters are essential for key functions. Members of the chloride channel (CLC) family located in intracellular organelles are required for anion accumulation, pH adjustment, and salt tolerance. Here, we cloned a maize (Zea mays L.) CLC gene, named ZmCLC-d, and found that its transcription was up-regulated under cold, drought, salt, and heat stresses, and after hydrogen peroxide (H₂O₂) and abscisic acid (ABA) treatments. The overexpression of ZmCLC-d in Arabidopsis conferred tolerance to cold, drought, and salt stresses; this tolerance was primarily displayed by an increased germination rate, root length, plant survival rate, antioxidant enzyme (catalase, peroxidase, and superoxide dismutase) activities, and a reduced accumulation of Cl^- in transgenic plants as compared with wild type (WT) plants. The accumulation of H₂O₂ and superoxide anion in leaves of the ZmCLC-d-overexpressing plants is much less than that of the WT plants. The expressions of some stress related genes, such as CBF1, CBF2, CBF3, DREB2A, and RCI2A, increased to a greater extent in the ZmCLC-d-overexpressing plants than in the WT. Our results strongly suggest that ZmCLC-d played an important role in stress tolerance.

Previously, the ascorbate peroxidase (APX1) activity and gene expression in Chinese cabbage (Brassica campestris, Bc) heat-tolerant cv. ASVEG2 were found to be significantly higher than in heat-sensitive cv. RN720 under a heat stress. Furthermore, BcAPX2 and BcAPX3, isoforms of BcAPX1, were cloned in this study. Our objective was to transfer BcAPX cDNA under the control of the ubiquitin promoter to Arabidopsis via Agrobacterium tumefaciens strain GV3101. We found that BcAPX genes were overexpressed in transgenic Arabidopsis, and the expression of APX, and the APX activity in transgenic lines were higher than in non-transgenic (NT) plants under high temperatures. The chlorophyll content and the germination rate were significantly higher, and the malondialdehyde content was lower in BcAPX1-3, 2-1, and 3-5 lines subjected to the heat-stress treatment than those in the NT plants. Compared to the NT plants, a lower heat-induced H₂O₂ accumulation was detected by diaminobenzidine staining in leaves of the transgenic lines with a high APX activity indicating that the overexpression of BcAPX in Arabidopsis could enhance heat tolerance by eliminating H₂O₂.

Saussurea involucrata Kar. et Kir. tolerates severe abiotic stresses including cold, and the level of membrane fatty acid desaturation is associated with its cold acclimation. We discovered and characterized a full-length cDNA of stearoyl acyl-carrier-protein desaturase (sikSACPD) which encodes a protein consisted of 396 amino acids. A sequence alignment of the SikSACPD protein showed that it shares 91 and 86 % identity with the SACPDs of Carthamus tinctorius and Helianthus annuus, respectively. Semi-quantitative RT-PCR showed that the expression of sikSACPD increased in S. involucrata leaves as the temperature decreased from 20 to -10 °C. Agrobacterium tumefaciens was used to transform fatty acid biosynthesis 2 (FAB2):SikSACPD and FAB2:FAB2 constructs into tobacco to investigate resistance to a freezing stress and fatty acid composition of the transgenic plants. The FAB2:SikSACPD transgenic plants showed a slightly more resistance to the freezing stress than the FAB2:FAB2 transgenic plants and the wild-type. The proportion of oleic acid (C18:1) in the leaves of SikSACPD transgenic tobacco increased from approximately 5 to 20 % compared with the leaves of non-transgenic tobacco when both were exposed to cold stress treatments. This study demonstrates that the SikSACPD transgene, when expressed in tobacco, conferred a higher cold tolerance in comparison with that observed in non-transgenic tobacco. Thus, this gene may be a candidate for enhancing cold tolerance in other crop plants.

Iron deficiency chlorosis occurs frequently in calcareous soils. The transformation of plants with ferric chelate reductase genes (FROs) provides a potential strategy to alleviate plant chlorosis under iron deficiency. A CjFRO2 gene isolated from Citrus junos Sieb. ex Tanaka was introduced into Poncirus trifoliata (L.) Raf via Agrobacterium-mediated transformation. The transgene integration and expression were confirmed by PCR, Southern blot, and real-time PCR analyses. Hydroponic- and soil-grown transgenic plants were tested for their tolerance to iron deficiency. Compared with nontransgenic (NT) P. trifoliata plants, a rhizosphere acidification capacity in the transgenic lines increased, and a ferric chelate reductase activity in roots was up to 3.39- and 2.93-fold higher in a hydroponic solution and soil, respectively. A transgenic line TO-8, which reacted similarly in hydroponics and soil, appeared tolerant to the iron deficiency. Its leaf chlorophyll and ferrous ion content was significantly higher than in NT. These results indicate that tolerance to the iron deficiency in P. trifoliata could be improved through the genetic engineering.

Plants face variable environmental stresses that negatively affect plant growth and productivity. The multiplicity of responses is an important aspect of the complexity of stress signalling. Abscisic acid (ABA) is a broad-spectrum phytohormone involved not only in regulating stomatal opening, growth and development but also in coordinating various stress signal transduction pathways in plants during abiotic stresses. The both ABA-dependent and ABA-independent signal transduction pathways from stress signal perception to gene expression involve different transcription factors such as DREB, MYC/MYB, AREB/ABF, NAM, ATAF1,2, CUC and their corresponding cis-acting elements DRE, MYCRS/MYBRS, ABRE, NACRS. Genetic analysis of ABA mutants has given insight that ABA-dependent and ABA-independent pathways for osmotic stress and cold stress interact and converge. This review focuses on ABA-dependent and ABA-independent transcriptional components and cascades, their specificity and crosstalk in stress gene regulation.

Tospoviruses are devastating plant viruses causing severe economic losses in a diverse range of crops worldwide. Here, we describe the development and evaluation of an RNA interference (RNAi) broad-spectrum virus resistance strategy based on a unique and short hairpin-RNA-generating construct (pNhpRNA). This construct was designed from a region of the nucleocapsid gene (N) of Tomato spotted wilt virus (TSWV) that showed a high sequence identity to the corresponding region in the related species Groundnut ringspot virus (GRSV) and Tomato chlorotic spot virus (TCSV). To test the effectiveness of the pNhpRNA construct, we developed a silencing reporter assay based on three fusion proteins in which the complete viral N gene sequence from each of the three tospoviruses was fused in frame to the green fluorescent protein (GFP) sequence. Co-agroinoculation of these constructs with pNhpRNA into leaves of Nicotiana benthamiana resulted in a strong silencing phenotype determined by GFP decay and suppression of the three N genes at the RNA and protein levels. To test the potential of the pNhpRNA construct to generate virus-resistant plants, we infiltrated the whole shoots of N. benthamiana with pNhpRNA. When these infiltrated plants were mechanically inoculated with the mentioned viruses 100, 70, and 60 % resistance phenotypes to TSWV, GRSV, and TCSV, respectively, were observed. The induction of a broad tospovirus resistance with a simple construct and a minimized off-target effect are the main contributions of pNhpRNA.

In plants, calcineurin B-like proteins (CBLs) and CBL-interacting protein kinases (CIPKs) regulate Ca2+ signalling and so responses to biotic and abiotic stresses. However, the details of specific CIPKs functions in various stress responses are poorly understood. Here, we report roles of dicot and monocot CIPK2 genes in response to salinity and heavy metals. Arabidopsis thaliana AtCIPK2 was found to be universally expressed in different tissues and organs and furthermore induced by salinity. Overexpression of AtCIPK2 or Tibetan Plateau wild barley (Hordeum spontaneum) HsCIPK2 in Arabidopsis alleviated toxic effects of NaCl and mercury on seed germination and root growth. Similarly, reduced toxic effects of copper and cadmium on seed germination, but not on root growth, were observed in these transgenic lines. Live-cell fluorescence imaging analysis revealed that HsCIPK2 was predominantly distributed in the cytoplasm and nucleus and weakly localized at the plasma membrane (PM), but its PM association was rapidly enhanced upon exposure to high salinity and mercury. These results suggest an involvement of CIPK2 in plant tolerance to salinity and mercury and provide a new insight into physiological functions of CIPKs in plant response to heavy metals.

Our research intended to appraise the performance of two different Pseudomonas strains on Zea mays L. (cv. B73) under drought stress and non-stress conditions. Plants were inoculated with P. putida KT2440 (Pp) and P. fluorescens (Pf1) followed by sampling at 0, 3^rd, and 6^th day after imposition of drought stress (DAS). Both strains demonstrated significant improvement in root length, protein content, chlorophyll content, and root and shoot fresh masses as compared to un-inoculated drought stressed plants. Real-time quantitative PCR analysis revealed that drought stress responsive genes, i.e., the cold-related dehydrin 410 gene, WRKY18, and major facilitator superfamily were significantly down-regulated by Pf1 and Pp inoculation under drought stress condition on 6 DAS. Similarly, the down-regulated transcript abundance of lipoxygenase genes in inoculated plants on 6 DAS showed the role of Pf1 and Pp in scavenging reactive oxygen species under drought stress conditions. Among the selected jasmonic acid pathway responsive genes, maize protease inhibitor and 12-oxo-phytodienoatereductase 7 (OPR7) also revealed a potential role of these rhizobacteria under drought stress conditions. Seed inoculation of both strains significantly down-regulated the expression of OPR7 gene under stress conditions. Our results advocate the complex growth promotion effects of both selected rhizobacterial strains and amelioration of the drought by modulating the expression of drought stress responsive genes.

Ethylene response factor (ERF) is a key transcription factor of plant ethylene signaling pathway, which plays an important role in plant response to abiotic and biotic stresses by regulating the expression of downstream genes. However, little is known about the mechanisms of the regulation of gene expression by ERF proteins. Chloroplast is an essential organelle that is important for photosynthesis and biosynthesis of many essential metabolites. There exists an interaction between chloroplasts and the nucleus. Chloroplasts can send multiple kinds of signals to regulate the nuclear gene expression known as retrograde signaling. In our study, we have analyzed the expression of the components related to plastid retrograde signaling pathway to elucidate the mechanism of tomato ethylene responsive factor 1 (TERF1) in response to drought stress. Our results showed that TERF1 can regulate different biogenic and operational retrograde signals to regulate nuclear genes expression, which can improve plant tolerance to drought stress. We also propose a new potential of TERF1 in regulating nuclear gene expression, including regulation of different phytohormone signaling pathways and gene posttranscriptional modification triggered by different retrograde signals. Our results have enriched our knowledge about the function of ERF proteins and ethylene signaling pathway.

An inhibitor of DNA methylation 5-azacytidine (5A) is a chemical analog of the nucleoside cytidine. This study investigated the influence of 5A-induced DNA hypomethylation on the accumulation of somatic DNA mutations (nucleotide substitutions, indels) in the Actin2 3′ untranslated region, nuclear internal transcribed spacer ITS1-5.8rRNA-ITS2, and the ribulose-1,5-bisphosphate carboxylase/oxygenase gene of Arabidopsis thaliana and analyzed concurrent changes in the expression of DNA methyltransferase and DNA repair genes. The 5A treatment (20 mg per 100 g of soil) decreased DNA methylation, and the detected 5A-induced demethylation was associated with the up-regulation of the DNA methyltransferase genes: chromomethylase AtCMT3, methyltransferase AtMETI, and domains rearranged methyltransferases AtDRM1 and AtDRM2. Cultivation of plants in the presence of 5A led to a considerable increase in the number of single nucleotide substitutions in the analyzed DNA regions of 5A-treated A. thaliana. The 5A treatment significantly increased the transcriptions of 7 DNA repair genes (endonuclease AtARP, DNA demethylases AtDME and AtDML2, DNA glycosylase AtMBD4, DNA damage-binding protein AtDDB1, and photolyases AtUVR2 and AtUVR3) out of the 17 analyzed genes from the base excision repair, nucleotide excision repair, and photoreactivation pathways. However, 5A decreased the transcription of DNA 3′-phosphatase AtZDP, DNA repair protein AtRad23a, mismatch repair proteins AtMsh2 and AtMsh3. It is possible that the changes in the transcription of the DNA repair genes contributed to the detected increase in the number of single nucleotide substitutions that accumulated in the 5A-treated A. thaliana. Taken together, the data indicate that there is an interaction between the processes of DNA methylation and mutation accumulation.

Several studies revealed the important contribution of calcineurin B-like (CBLs) and CBL-interacting kinase (CIPKs) genes in transmitting stress signals in plants. Taking advantage from the genome sequences of the cultivated potato Solanum tuberosum and its wild relatives S. commersonii and S. chacoense, we identified for the first time 10 CBLs and 26 CIPKs genes in each species. The CBLs and CIPKs derived from tandem duplications indicate that these gene families in potato mainly arise through amplification mechanisms. Once annotated, we compared the par excellence model of Arabidopsis thaliana with S. commersonii, the potato model species for studying cold tolerance. We found that four ScCBL proteins (ScCBL1, ScCBL4a, ScCBL4b, and ScCBL9) started with a conserved N-myristoylation motif (MGXXXS/T), which might function in membrane targeting of the CBLs-CIPKs complex. Additionally, expression analyses of S. commersonii CBL and CIPK genes based on RNAseq revealed diverse expression patterns following various abiotic and biotic stresses and in the four tissues analyzed (flowers, leaf, roots, and tubers). Data also suggest that the ScCBLs-ScCIPKs complex may be more responsive to abiotic rather than biotic stimuli. Overall, the results described in the present work will be useful for future investigations and for functional characterization of individual CBLs and CIPKs in Solanum.