Fulltext search in archive
Results 211 to 240 of 2239:
Shoot proliferation and organogenesis on Arbutus unedo: physiological analysis under water stressJ.F. Martins, S. Correia, B. Correia, G. Pinto, J.M. CanhotoBiologia plantarum 63:278-286, 2019 | DOI: 10.32615/bp.2019.032 Strawberry tree (Arbutus unedo) is a small perennial tree that grows spontaneously in the Mediterranean basin, Ireland, and Portugal. In this work, strawberry tree clones were established in vitro from epicormic shoots obtained from a young tree, an adult tree, and from a seedling. They were propagated by axillary shoot buds proliferation on solid and in liquid media, and also in a modified De Fossard medium with 9 µM benzylaminopurine. The organogenesis from calli obtained from apical leaves of the in vitro grown shoots from the three genotypes was carried out in the same basal liquid medium supplemented with 9 µM thidiazuron. Micropropagation through organogenesis in liquid medium proved to be more efficient than the other tested methods (considering the number of shoots produced), but the shoots were showing hyperhydricity. Shoots were sucessufully rooted on medium with indole-3-butyric acid and acclimatized ex vitro with rates higher than 90 %. Six month-old plants from the most proliferative genotype (AU1) and propagated in vitro by different methods were submitted to drought stress (no watering for 10 d) and several morphological and physiological parameters were evaluated and compared to a control group (watered to 70 % field capacity). No significant differences were found in plant biomass, root length, and plant height, however, slight differences were observed in water potential, net photosynthetic rate, intercellular CO2 concentration, and stomatal conductance between the plantlets propagated on solid or liquid medium. In general, the responses to drought stress imposed were was similar in plants micropropagated by different propagation methods. |
Recent advances and perspectives in crop biofortificationT. VLÈKO, L. OHNOUTKOVÁ*Biologia plantarum 63:586-593, 2019 | DOI: 10.32615/bp.2019.056 The increasing world population and limited amount of land area appropriate for intensive agriculture necessitate high-yield cultivars. The focus is on the enrichment of existing crops deficient in nutrients, which is also called biofortification. Microelements, vitamins, and fatty acids belong to most important traits being subjected to biofortification. Biofortification strategies can be divided on fertilization-based strategy, which is characterized by direct application of nutrients or plant growth promoting substances on plants, and biotechnological strategy, which involves molecular biology techniques in order to enhance transport, production, and accumulation of nutrients. Recent advances in plant biotechnology, such as genome-editing, clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9, and transcription activator-like effector nuclease, as well as an extensive study of genetic diversity, are acceptable approaches to the development of biofortified crops. |
Overexpression of CBL interacting protein kinase 2 improves plant tolerance to salinity and mercuryW.H. Pan, Z.Z. Zheng, X. Yan, J.Q. Shen, J.X. Shou, L.X. Jiang, J.W. PanBiologia plantarum 63:183-192, 2019 | DOI: 10.32615/bp.2019.021 In plants, calcineurin B-like proteins (CBLs) and CBL-interacting protein kinases (CIPKs) regulate Ca2+ signalling and so responses to biotic and abiotic stresses. However, the details of specific CIPKs functions in various stress responses are poorly understood. Here, we report roles of dicot and monocot CIPK2 genes in response to salinity and heavy metals. Arabidopsis thaliana AtCIPK2 was found to be universally expressed in different tissues and organs and furthermore induced by salinity. Overexpression of AtCIPK2 or Tibetan Plateau wild barley (Hordeum spontaneum) HsCIPK2 in Arabidopsis alleviated toxic effects of NaCl and mercury on seed germination and root growth. Similarly, reduced toxic effects of copper and cadmium on seed germination, but not on root growth, were observed in these transgenic lines. Live-cell fluorescence imaging analysis revealed that HsCIPK2 was predominantly distributed in the cytoplasm and nucleus and weakly localized at the plasma membrane (PM), but its PM association was rapidly enhanced upon exposure to high salinity and mercury. These results suggest an involvement of CIPK2 in plant tolerance to salinity and mercury and provide a new insight into physiological functions of CIPKs in plant response to heavy metals. |
Molecular and physiological analysis of drought stress responses in Zea mays treated with plant growth promoting rhizobacteriaI. AHMAD, S. ZAIB, P.C.M.S. ALVES, D.S. LUTHE, A. BANO, S.N. SHAKEELBiologia plantarum 63:536-547, 2019 | DOI: 10.32615/bp.2019.092 Our research intended to appraise the performance of two different Pseudomonas strains on Zea mays L. (cv. B73) under drought stress and non-stress conditions. Plants were inoculated with P. putida KT2440 (Pp) and P. fluorescens (Pf1) followed by sampling at 0, 3rd, and 6th day after imposition of drought stress (DAS). Both strains demonstrated significant improvement in root length, protein content, chlorophyll content, and root and shoot fresh masses as compared to un-inoculated drought stressed plants. Real-time quantitative PCR analysis revealed that drought stress responsive genes, i.e., the cold-related dehydrin 410 gene, WRKY18, and major facilitator superfamily were significantly down-regulated by Pf1 and Pp inoculation under drought stress condition on 6 DAS. Similarly, the down-regulated transcript abundance of lipoxygenase genes in inoculated plants on 6 DAS showed the role of Pf1 and Pp in scavenging reactive oxygen species under drought stress conditions. Among the selected jasmonic acid pathway responsive genes, maize protease inhibitor and 12-oxo-phytodienoatereductase 7 (OPR7) also revealed a potential role of these rhizobacteria under drought stress conditions. Seed inoculation of both strains significantly down-regulated the expression of OPR7 gene under stress conditions. Our results advocate the complex growth promotion effects of both selected rhizobacterial strains and amelioration of the drought by modulating the expression of drought stress responsive genes. |
Gene expression analysis reveals function of TERF1 in plastid-nucleus retrograde signaling under drought stress conditionsW. Wu, L.-L. Liu, T. Yang, J.-H. Wang, J.-Y. Wang, P. Lv, Y.-C. YanBiologia plantarum 62:428-438, 2018 | DOI: 10.1007/s10535-018-0771-x Ethylene response factor (ERF) is a key transcription factor of plant ethylene signaling pathway, which plays an important role in plant response to abiotic and biotic stresses by regulating the expression of downstream genes. However, little is known about the mechanisms of the regulation of gene expression by ERF proteins. Chloroplast is an essential organelle that is important for photosynthesis and biosynthesis of many essential metabolites. There exists an interaction between chloroplasts and the nucleus. Chloroplasts can send multiple kinds of signals to regulate the nuclear gene expression known as retrograde signaling. In our study, we have analyzed the expression of the components related to plastid retrograde signaling pathway to elucidate the mechanism of tomato ethylene responsive factor 1 (TERF1) in response to drought stress. Our results showed that TERF1 can regulate different biogenic and operational retrograde signals to regulate nuclear genes expression, which can improve plant tolerance to drought stress. We also propose a new potential of TERF1 in regulating nuclear gene expression, including regulation of different phytohormone signaling pathways and gene posttranscriptional modification triggered by different retrograde signals. Our results have enriched our knowledge about the function of ERF proteins and ethylene signaling pathway. |
Somatic mutations, DNA methylation, and expression of DNA repair genes in Arabidopsis thaliana treated with 5-azacytidineK.V. Kiselev, Z.V. Ogneva, A.S. Dubrovina, N.N. Nityagovsky, A.R. SuprunBiologia plantarum 63:398-404, 2019 | DOI: 10.32615/bp.2019.051 An inhibitor of DNA methylation 5-azacytidine (5A) is a chemical analog of the nucleoside cytidine. This study investigated the influence of 5A-induced DNA hypomethylation on the accumulation of somatic DNA mutations (nucleotide substitutions, indels) in the Actin2 3′ untranslated region, nuclear internal transcribed spacer ITS1-5.8rRNA-ITS2, and the ribulose-1,5-bisphosphate carboxylase/oxygenase gene of Arabidopsis thaliana and analyzed concurrent changes in the expression of DNA methyltransferase and DNA repair genes. The 5A treatment (20 mg per 100 g of soil) decreased DNA methylation, and the detected 5A-induced demethylation was associated with the up-regulation of the DNA methyltransferase genes: chromomethylase AtCMT3, methyltransferase AtMETI, and domains rearranged methyltransferases AtDRM1 and AtDRM2. Cultivation of plants in the presence of 5A led to a considerable increase in the number of single nucleotide substitutions in the analyzed DNA regions of 5A-treated A. thaliana. The 5A treatment significantly increased the transcriptions of 7 DNA repair genes (endonuclease AtARP, DNA demethylases AtDME and AtDML2, DNA glycosylase AtMBD4, DNA damage-binding protein AtDDB1, and photolyases AtUVR2 and AtUVR3) out of the 17 analyzed genes from the base excision repair, nucleotide excision repair, and photoreactivation pathways. However, 5A decreased the transcription of DNA 3′-phosphatase AtZDP, DNA repair protein AtRad23a, mismatch repair proteins AtMsh2 and AtMsh3. It is possible that the changes in the transcription of the DNA repair genes contributed to the detected increase in the number of single nucleotide substitutions that accumulated in the 5A-treated A. thaliana. Taken together, the data indicate that there is an interaction between the processes of DNA methylation and mutation accumulation. |
Genes involved in stress signals: the CBLs-CIPKs network in cold tolerant Solanum commersoniiS. ESPOSITO, V. D'AMELIA, D. CARPUTO*, R. AVERSANO*Biologia plantarum 63:699-709, 2019 | DOI: 10.32615/bp.2019.072 Several studies revealed the important contribution of calcineurin B-like (CBLs) and CBL-interacting kinase (CIPKs) genes in transmitting stress signals in plants. Taking advantage from the genome sequences of the cultivated potato Solanum tuberosum and its wild relatives S. commersonii and S. chacoense, we identified for the first time 10 CBLs and 26 CIPKs genes in each species. The CBLs and CIPKs derived from tandem duplications indicate that these gene families in potato mainly arise through amplification mechanisms. Once annotated, we compared the par excellence model of Arabidopsis thaliana with S. commersonii, the potato model species for studying cold tolerance. We found that four ScCBL proteins (ScCBL1, ScCBL4a, ScCBL4b, and ScCBL9) started with a conserved N-myristoylation motif (MGXXXS/T), which might function in membrane targeting of the CBLs-CIPKs complex. Additionally, expression analyses of S. commersonii CBL and CIPK genes based on RNAseq revealed diverse expression patterns following various abiotic and biotic stresses and in the four tissues analyzed (flowers, leaf, roots, and tubers). Data also suggest that the ScCBLs-ScCIPKs complex may be more responsive to abiotic rather than biotic stimuli. Overall, the results described in the present work will be useful for future investigations and for functional characterization of individual CBLs and CIPKs in Solanum. |
Effects of short-term arsenic exposure in Arabidopsis thaliana: tolerance versus toxicity responsesA. Pita-Barbosa, T.C.R. Williams, M.E. LoureiroBiologia plantarum 63:43-53, 2019 | DOI: 10.32615/bp.2019.006 The metalloid arsenic (As) is highly phytotoxic, in part due to the similarity of the arsenates to phosphates, but also due to its ability to induce reactive oxygen species (ROS) formation, and in the form of arsenite directly interact with certain enzymes. Here we aimed to determine the effects of a short period of As exposure on Arabidopsis thaliana. Particular focus was given to shoot responses, which have received less attention in previous studies. A. thaliana (ecotype Col-0) plants (28-d-old) were cultivated hydroponically in the presence of 0, 27, 108, and 216 µM arsenic in the form of sodium arsenate for five days. Translocation of As from root to shoot increased with increasing As concentration in the medium and caused a reduction in growth. Photosynthesis was severely affected due to stomatal closure, increased ROS accumulation, and alterations in expression of genes involved in oxidative stress responses and As detoxification. Primary metabolism was also perturbed, suggesting both the direct inhibition of certain enzymes as well as active defensive responses. Overall the effects of As toxicity depended greatly on the degree of translocation from root to shoot and involved both direct effects on biological processes and secondary effects caused by the accumulation of ROS. |
Expression profile analysis of MATE gene family in riceJ.J. HUANG, W. J. AN, K. J. WANG, T.H. JIANG, Q. REN, W.H. LIANG, H.H. WANG*Biologia plantarum 63:556-564, 2019 | DOI: 10.32615/bp.2019.099 Multidrug and toxic compound extrusion (MATE) proteins is a newly characterized transporter family in plants. However, knowledge of this family in systematic classification, molecular evolution, and expression patterns in plants is limited. In this study, MATE gene sequence, structure, and names as well as MATE protein size and subcellular localization in rice were analyzed using bioinformatics tools, chromosome localizations, and gene clusters. The function of MATE proteins was further elucidated on a basis of phylogenetic relationships. Using available transcriptomic data, the expression pattern and function of MATE were different in the selected organs and developments stages of rice. In addition, the relative abundance of OsMATE1 transcripts increased 3 h after copper treatment and so it was identified as a candidate gene for Cu tolerance in rice. This research provided basic data for further studies on MATE genes in rice and theoretical information about the biological function of MATE proteins. |
Aluminum alleviates boron-deficiency induced growth impairment in tea plantsR. Hajiboland, S. Bahrami-Rad, S. BastaniBiologia plantarum 58:717-724, 2014 | DOI: 10.1007/s10535-014-0425-6 Interaction between aluminum (Al) and boron (B) in Al accumulator species has not been characterized so far. In this work, tea [Camellia sinensis (L.) O. Kuntze] plants were cultivated hydroponically and treated with adequate (control) or low B supply (-B) without or with 300 μM Al (-B+Al) for 14 weeks. Growth of B-deficient plants was completely resumed by Al supplementation or even surpassed control plants regarding shoot biomass. Net photosynthetic rate was negatively influenced by the low B supply, and the Al treatment increased it up to the level of the control plants that was reflected in the higher content of saccharides. The activity of ascorbate peroxidase (APX) in the younger leaves decreased at the low B supply accompanied with an increased H2O2 content. The Al treatment increased the APX activity up to the level of the control plants simultaneously with the reduction of H2O2. Activities of superoxide dismutase (SOD) and peroxidase (POD) increased in the low B plants and the Al treatment augmented this effect. The content of malondialdehyde (MDA) in the leaves increased by low B but declined upon the Al treatment. In the Al-treated plants, the activity of nitrate reductase (NR) and the content of free α-amino acids exceeded those of the control plants, and nitrite concentration diminished. The shoot and root B content of the B-deficient plants supplemented with Al was similar with the B-sufficient ones. The results demonstrate that the up-regulation of C and N metabolism, the activation of antioxidative defense, and the enhancement of B uptake and transport were mechanisms for growth amelioration of the B-deficient plants by Al supplementation in tea. |
Overexpression of glycine-rich RNA-binding protein in tomato renders fruits with higher protein content after cold storageG. M. Ruggieri, A. Triassi, C. E. Alvarez, A. Gola, J. Wiggenhauser, C. O. Budde, M. V. Lara, M. F. Drincovich, G. L. MüllerBiologia plantarum 62:501-510, 2018 | DOI: 10.1007/s10535-018-0794-3 Glycine-rich RNA-binding proteins (GR-RBPs) are involved in RNA processing and also some of them are output signals of the circadian clock. In tomato, one GR-RBP gene family (LeGRP1) is composed by three highly homologous genes (LeGRP1a-c); each one rendering three transcriptional products: the un-spliced pre-RNA (preLegrp1a-c), the mature mRNA (mLegrp1a-c) and the alternatively spliced mRNA (asLegrp1a-c). To get insight into their regulation and impact on RNA metabolism in fruits, Solanum lycopersicum cv. Micro-Tom was transformed with preLeGRP1a fused to the polygalacturonase promoter, which drives expression to fruits from the mature green stage. Our results demonstrated a complex positive regulation of LeGRPs, in which LeGRP1a overexpression led to the induction of the others LeGRP1 members. Even though the LeGRP1 transcription and the content of three LeGRPs proteins were affected, the overall LeGRP protein circadian rhythm profile was similar in transgenic and wild type (WT) fruits. However, when the fruits were kept at a chilling temperature after harvest, total protein content was significantly higher in transgenic than in WT fruits, and the content of some free amino acids was modified. The results obtained suggest a probable role of LeGRP1s: structural rearrangements and/or stabilization of mRNA to allow efficient processing of fruits under cold conditions. |
Implication of peroxisomes and mitochondria in the halophyte Cakile maritima tolerance to salinity stressN. Ben Amor, A. Jimenez, M. Boudabbous, F. Sevilla, C. AbdellyBiologia plantarum 63:113-121, 2019 | DOI: 10.32615/bp.2019.014 The role of mitochondria and peroxisomes in the tolerance of the halophyte Cakile martima to salt stress was studied. The plants were subjected to 0, 100, and 200 mM NaCl for 5 weeks. The evaluation of oxidative stress according to the content of malondialdehyde (MDA), carbonyl (CO-) proteins, O2-, and H2O2, and the activities of several antioxidant enzymes, such as superoxide dismutase, peroxidase, and enzymes of the ascorbate-glutathione cycle were determined in two purified organelles, mitochondria and peroxisomes. The intact organelles were purified by centrifugation in Percoll density gradients. Results show that the content of MDA and CO- proteins was higher in mitochondria than in peroxisomes under the salt stress. The antioxidant enzymes showed higher activities in peroxisomes than in mitochondria under different NaCl concentrations. These activities were highest at 100 mM NaCl. Our results suggest that the ascorbate glutathione cycle in peroxisomes plays a key role in the tolerance of Cakile maritima to salinity. |
Growth, secondary metabolism, and related gene expression in response to interactions of nitrogen and sulfur in Isatis indigoticaY.J. Miao, R.J. Qu, J.T. Sha, Y.W. Cao, J.L. Guan, J. Xu, X.Q. Tang, F.Q Wang, J. YangBiologia plantarum 63:411-417, 2019 | DOI: 10.32615/bp.2019.053 Nitrogen and sulfur are major elements influencing plant growth and production of secondary metabolites. They interact to each other, but little is known about it in Isatis indigotica Fort. plants. In this study, 15 different treatments representing all possible combinations of 3 N treatments (N1, N2, and N3, corresponding to 5, 15, and 25 mM N, respectively) and five S treatments (S0, S1, S2, S3, and S4, corresponding to 0.00, 1.25, 2.50, 5.00 and 7.50 mM S, respectively) were used, and plant growth, indigo and indirubin yields, and expressions of genes encoding enzymes involved in N and S metabolisms were measured. The results show that the highest dry biomass was observed in N2S2 treatment. Moreover, net photosynthetic rate in the N2S2 treatment was significantly higher than under other treatments (except for N3S2 treatment). A low nitrogen concentration (5 mM) was beneficial to the accumulation of alkaloids, and the N1S1 and N2S2 treatments resulted in the highest yields of indigo and indirubin, respectively. Additionally, the yields of indigo and indirubin were positively correlated with the expression of APS reductase and glutamine synthetase genes, respectively. |
A genome-wide analysis of the cellulose synthase-like (Csl) gene family in maizeY. LI, X. CHENG, Y. FU, Q. WU, Y. GUO, J. PENG, W. ZHANG, B. HEBiologia plantarum 63:721-732, 2019 | DOI: 10.32615/bp.2019.081 Cell walls play an important role in the structure and morphology of plants as well as in responses to various biotic and abiotic stresses. Although the comprehensive analysis of genes involved in cellulose synthase has been performed in model plants, such as Arabidopsis thaliana and rice, information regarding cellulose synthase-like (Csl) genes in maize is limited. In this study, a total of 56 members of Csl gene family were identified in maize genome and classified into six subfamilies. Analysis of gene structure and conserved motif indicated functional similarities among the ZmCsl proteins within the same subfamily. Additionally, the 56 ZmCsl genes were dispersed on 10 chromosomes. The expression patterns of ZmCsl genes in different tissues using the transcriptome data revealed that most of ZmCsl genes had a relatively high expression in root and tassel tissues. Moreover, the expression profiles of ZmCsl genes under drought and re-watering indicated that the expression of ZmCsl genes were mainly responsive to early stage of drought stress. The protein-protein interaction network of ZmCsl proposed some potentially interacting proteins. The data presented a comprehensive survey of Csl gene family in maize. The detailed description of maize Csl genes will be beneficial to understand their structural, functional, and evolutionary features and provide an important foundation for studying the roles of ZmCsl genes in response to biotic and abiotic stresses. |
The homoeologous genes encoding C24-sterol methyltransferase 1 in Triticum aestivum: structural characteristics and effects of cold stressA. Renkova, J. Valitova, H. Schaller, F. MinibayevaBiologia plantarum 63:59-69, 2019 | DOI: 10.32615/bp.2019.008 A unique structural feature of plant sterols is the presence of a 24-alkyl group in the sterol side chain, which is synthesized by C24-sterol methyltransferase (SMT). Here we report for the first time that the bread wheat genome (AABBDD) contains at least three homoeologous genes encoding C24-sterol methyltransferase 1. While these copies have similar coding regions, they differ markedly in the nucleotide sequences of their non-coding regions. Sequencing de novo of the promoter regions of the TaSMT1 homoeologs demonstrated the occurrence of common and specific stress-sensitive cis-elements such as LTR, the cis-element involved in low temperature response. These cis-elements, along with other factors, determine the differences in the effects of stress on the expression of homoeologous TaSMT1 genes. For example, TaSMT1-5A is constitutively expressed in the roots and leaves, while TaSMT1-4D gene is highly stress-responsive. Another important enzyme involved in sterol biosynthesis is C22-sterol desaturase, which converts β-sitosterol into stigmasterol. This enzyme is encoded by homoeologous TaCYP710A8 genes, which, in contrast to TaSMT1, are all up-regulated in response to stress. Cold-induced expression of TaCYP710A8 is greater in roots than in leaves. This may be due to the higher cold sensitivity of the roots and the necessity to increase the amount of stigmasterol known as a “stress sterol”. Our findings suggest that the existence of homoeologous genes of sterol biosynthesis in polyploid plants supports the diversity of genetic mechanisms of sterol-mediated response of plants to stresses. |
Sense- and antisense-mediated resistance against Sri Lankan cassava mosaic virus (SLCMV) in Nicotiana benthamianaA. GOGOI, A. KALDIS, I. DASGUPTA, B.K. BORAH, A. VOLOUDAKISBiologia plantarum 63:455-464, 2019 | DOI: 10.32615/bp.2019.079 Sri Lankan cassava mosaic virus (SLCMV) is the principal causal agent of cassava mosaic disease in the Indian subcontinent. To gain resistance against the virus, the coat protein (CP) gene, namely the AV1 of SLCMV-Adivaram isolate, was cloned in either sense or antisense orientation under the Cauliflower mosaic virus 35S promoter, and transgenic Nicotiana benthamiana plants were obtained through Agrobacterium-mediated transformation. A total of eight T1 transgenic lines, four harboring the CP-sense construct and four harboring the CP-antisense construct were challenged with agro-infectious clones of SLCMV DNA-A and DNA-B. Based on symptom exhibition at 20 days post inoculation, 3 out of the 4 CP-sense transgenic lines and all 4 CP-antisense transgenic lines showed a high level of resistance against SLCMV. In addition, a delay in symptom initiation was observed in all the transgenic lines inoculated with a high viral load at agro-dilution 1:625 from an absorbance (A600) of 1. However, the resistance was more prominent at a lower viral load of 1:1000 agro-dilution. The viral titer was lower in the SLCMV-challenged transgenic lines compared to the non-transgenic N. benthamiana plants as confirmed by quantitative PCR and dot blot analysis. Furthermore, small RNA Northern blot analysis revealed lowered amounts of virus-specific small interfering RNAs in the resistant transgenic lines as compared to the non-transgenic plants upon SLCMV infection, which correlates to lower virus titers due to resistance against the virus. |
Effects hydrogen sulfide on the antioxidant system and membrane stability in mitochondria of Malus hupehensis under NaCl stressG.-Q. Wei, W.-W. Zhang, H. Cao, S.-S. Yue, P. Li, H.-Q. YangBiologia plantarum 63:228-236, 2019 | DOI: 10.32615/bp.2019.026 Salt stress is one of the most critical environmental factors limiting plant growth, and hydrogen sulfide (H2S) can play a role in plant responses to this stress. To investigate the effects of H2S on mitochondrial functions under salt stress, we treated Malus hupehensis Rehd. var. pingyiensis germinating seeds with an 85 mM NaCl solution with or without an H2S donor sodium hydrosulfide (NaHS) and H2S scavenger hypotaurine (HT). Then, hydrogen peroxide (H2O2) content and antioxidant enzyme activities were measured in mitochondria of seedling roots. Our results show that the application of 0.05 mM NaHS rescued an NaCl-induced inhibition of root elongation, decreased H2O2 content, and enhanced superoxide dismutase (SOD), guaiacol peroxidase (POD), and catalase (CAT) activities in the mitochondria compared to NaCl treatment alone. It was also found that 0.05 mM NaHS significantly decreased the mitochondrial permeability transition pore and increased mitochondrial membrane fluidity, mitochondrial membrane potential, and cytochrome c/a ratio under NaCl stress. However, 0.02 mM NaHS did not affect root growth, antioxidant enzyme activities, and mitochondrial function under NaCl stress, whereas high concentrations of NaHS (more than 0.2 mM) had a weaker or negative effects. Moreover, 15 µM HT eliminated the beneficial effects of NaHS under NaCl stress. Our results suggest that H2S protected plants against salt stress by decreasing H2O2 accumulation and by regulating membrane stability and antioxidant system in mitochondria. |
Production of triploid plants from endosperm cultures of Phlox drummondiiA. Razdan Tiku, M. K. Razdan, S. N. RainaBiologia plantarum 58:153-158, 2014 | DOI: 10.1007/s10535-013-0372-7 Triploid plants of ornamental Phlox drummondii Hook. were raised from cultures of endosperm excised from immature fruits having zygotic embryo at early dicotyledonous stage. Endosperm tissue was firstly cultured with the embryo on the Murashige and Skoog's (MS) medium supplemented with 5 μM 6-benzylaminopurine (BAP) + 10 μM α-napthaleneacetic acid (NAA) for 7 d and recultured after the embryo was removed. A friable callus appeared two weeks after removal of the embryo and it became compact callus mass in another three weeks. Upon transfer of this 5-week-old callus to the MS medium with 10 μM BAP + 2.5 μM indole-3-acetic acid (IAA), maximum percentage of green nodular shoot buds appeared from which regenerated dwarf shoots. Elongation of the dwarf shoots, however, required transfer of the individual dwarf shoots excised from the callus on the fresh medium and best results achieved on medium with low concentration of IAA (0.5 μM) in presence of 10 μM BAP. The shoots were then rooted in vitro and plants subsequently established in pots containing soil. Over 70 % of plants were triploid with a chromosome number of 2n=3x=21. Size of stem, leaves, flowers, pollen, and stomata of these triploid plants were higher and the plants were more vigorous as compared to naturally occurring diploid plants. In particular, flowers showed bright colour with enlarged central eye adding to their ornamental value. |
The intensity of and recovery from photoinhibition under drought in a thermotolerant common bean compared to drought tolerant genotypesD.C. MACEDO, G.R. LIMA, R.L.N. BARROS, C. PIMENTELBiologia plantarum 63:465-473, 2019 | DOI: 10.32615/bp.2019.076 The chlorophyll a fluorescence parameters of four Phaseolus vulgaris L. genotypes were evaluated under drought in two greenhouse experiments. Under severe water stress, the thermotolerant genotype 'Diplomata' maintained significantly higher values of predawn leaf water potential (Ψw), maximum Fv/Fm and effective (ΦPSII) quantum yield of photosystem II , and non-photochemical quenching than 'Ouro Negro', in the first experiment, and 'A 285' and 'A 222', in the second one. Among these parameters, Fv/Fm showed more differences that discriminated between the genotype responses even when measured at night. Next, a difference between Fv/Fm after sundown and Fv/Fm at dawn on the same day (day ∆Fv/Fm), i.e., the intensity of photoinhibition, and a difference between Fv/Fm at dawn and Fv/Fm after sundown on the day before (night ∆Fv/Fm), i.e. the photoinhibition recovery, were evaluated. Day ∆Fv/Fm and night ∆Fv/Fm were significantly higher for 'Diplomata' under severe water stress in both experiments. In addition, 'Ouro Negro' in the first experiment and all the genotypes in the second showed negative values of night ∆Fv/Fm on the last day of drought when their Ψw were also minimal indicating no recovery from photoinhibition and the need for rehydration. At maturation, stressed plants of 'Diplomata' showed a significantly higher yield than 'Ouro Negro' in the first experiment and the same as 'A 285' in the second. Therefore, the thermotolerant genotype 'Diplomata' also showed drought tolerance, and the use of day ∆Fv/Fm and night ∆Fv/Fm fluorescence analysis was able to discriminate between the tolerances of these genotypes and to indicate the need for rehydration. |
Overexpression of a gene AhFBA from Arachis hypogaea confers salinity stress tolerance in Escherichia coli and tobaccoZ.K. Du, Y.F. Hu, J.M. LiBiologia plantarum 63:122-133, 2019 | DOI: 10.32615/bp.2019.015 Fructose-1,6-bisphosphate aldolase (FBA), an essential enzyme involved in the glycolytic pathway, gluconeogenesis, and the Calvin cycle, plays significant roles in the regulation of plant growth, development, and stress responses. In this study, a novel gene, AhFBA (GenBank accession number KF470788), containing a 1077-bp open reading frame and encoding a protein of 358 amino acids, was isolated from Arachis hypogaea L. Bioinformatic analysis revealed that AhFBA belonged to class-I aldolases and preferentially localized in the cytoplasm. Real-time quantitative PCR analysis indicated that AhFBA had a higher expression in young fruits than in leaves and stems, and NaCl could trigger the highest expression of AhFBA in roots and leaves after 3-h and 6-h treatments. The salinity tolerance and survival of Escherichia coli transformed with AhFBA were notably enhanced compared with the control. Transgenic tobacco (Nicotiana tabacum L.) overexpressing the AhFBA gene exhibited a lower hydrogen peroxide content, electrolyte leakage, and malondialdehyde content and a higher photosynthetic efficiency, net photosynthetic rate, relative water content, and sucrose and proline content compared with control plants. Taken together, the results demonstrate that AhFBA functioned as a positive factor enhancing the tolerance of E. coli and N. tabacum to salinity stress, possibly by maintaining the osmotic balance and scavenging hydrogen peroxide. |
Effects of various winter chilling regimes on flowering quality indicators of Greek olive cultivarsG. KOUBOURIS, I. LIMPERAKI, M. DARIOTI, C. SERGENTANIBiologia plantarum 63:504-510, 2019 | DOI: 10.32615/bp.2019.065 Aims of the present two-year study were to evaluate the feasibility and identify potential drawbacks of the greenhouse/outdoors parallel plant growth methods for investigation of the effects of various winter chilling regimes on flowering quality indicators of four Greek olive cultivars, namely Mastoidis, Amfissis, and Lefkolia Serron (originating from mountainous and colder areas) compared to cv. Koroneiki (grown mainly in plain warm areas). Groups of potted olive plants were either grown outdoors under ambient temperature or transferred into a greenhouse for one, two, or three months during winter in Crete, Greece. During the first year, chilling accumulation deficit caused a marked decrease in the number of inflorescences per plant in all four olive cultivars. In the second year, chilling accumulation deficit had a negative effect on the number of inflorescences per plant in 'Mastoidis' at 3-month greenhouse treatment but not at all in 'Koroneiki'. Chilling deficit caused an overall decrease in the number of flowers per inflorescence in both 'Koroneiki' and 'Mastoidis' as well as in the percentage of morphologically perfect flowers. The width and length of inflorescences were not affected by chilling deficit in both the cultivars. In vitro pollen germination was reduced in all greenhouse treatments in 'Koroneiki'; however, this effect was significant only after 3 month, whereas no effect was observed in 'Mastoidis'. The results of the present study may contribute to understanding olive flowering biology and selecting appropriate cultivars for new plantations according to historical meteorological data and predicted climate change scenarios. |
OsCaM1-1 overexpression in the transgenic rice mitigated salt-induced oxidative damageT. Kaewneramit, T. Buaboocha, P. Sangchai, N. WutipraditkulBiologia plantarum 63:335-342, 2019 | DOI: 10.32615/bp.2019.039 Various physiological and biochemical parameters associated with improved salinity tolerance in the transgenic rice lines overexpressing OsCaM1-1 gene and wild-type KDML105 were compared 3 d after exposure to 150 mM NaCl. The results showed higher relative water content, relative growth rate, content of photosynthetic pigments (chlorophylls a, b, and carotenoids), DPPH scavenging activity, and activities of superoxide dismutase, catalase, ascorbate peroxidase, and glutathione reductase in the transgenic plants when compared with the wild-type and control, KDML105 transformed with blank vector, whereas H2O2 content, Na/K and Na/Ca ratio, lipid peroxidation, and electrolytic leakage were lower. Taken together, the OsCaM1-1 gene overexpression probably reduced salt-induced oxidative damage in the transgenic plants by enhancing the activities of antioxidant enzymes. |
A novel potato microRNA stu-miR856 regulates mitogen-activatedprotein kinase genes contributing to drought toleranceJ.W. YANG, X. ZHU, S.G. LI, X. TANG, N. ZHANG, H.J. SIBiologia plantarum 63:618-626, 2019 | DOI: 10.32615/bp.2019.067 Mitogen-activated protein kinases (MAPKs) are significant components of MAPK cascades, which play versatile roles in different transduction pathways to mediate stress adaptation. However, little information is known about post-transcriptional regulation of MAPK genes in plant under drought stress. MicroRNAs (miRNAs), a class of newly identified, short non-coding RNAs, regulate the expression of target genes in plant growth, development, and stress responses. In order to investigate the mechanism of miRNA regulating MAPK genes in potato, we identified a novel potato miRNA with the sequence CGGCCTTAATAAGATGGTGAAG and named it as stu-miR856 depending on miRNA deep sequencing and bioinformatic analysis. Target prediction indicates that it can bind to the coding sequence region of two potato MAPK-like genes, and cleavage positions of them were also effectively validated by RNA ligase-mediated 5' rapid amplification of cDNA ends assay. In addition, expressional analysis shows that stu-miR856 and its targets exhibited an opposite expression pattern: stu-miR856 expression significantly decreased while its target genes greatly increased in the different stages of drought treatment. The results indicate that a decreased expression of stu-miR856 might drive overexpression of two StMAPK genes family members, which may contribute to regulation of the drought adaptation of potato plants. |
Over-expression of heat shock protein gene hsp26 in Arabidopsis thaliana enhances heat toleranceY. Xue, R. Peng, A. Xiong, X. Li, D. Zha, Q. YaoBiologia plantarum 54:105-111, 2010 | DOI: 10.1007/s10535-010-0015-1 In the yeast Saccharomyces cerevisiae, the molecular chaperone HSP26 has the remarkable ability to sense increases in temperature directly and can switch from an inactive to a chaperone-active state. In this report, we analyzed the effect of expression of HSP26 in Arabidopsis thaliana plants and their response to high temperature stress. The hsp26 transgenic plants exhibited stronger growth than wild type plants at 45 °C for 16 h. The chlorophyll content and chlorophyll fluorescence decreased much more in wild type than in transgenic plants. Moreover, the transgenic plants had higher proline and soluble sugar contents, and lower relative electrical conductivity and malondialdehyde contents after high temperature stress. Furthermore, we found that over-expression of HSP26 in Arabidopsis increased the amount of free proline, elevated the expression of proline biosynthetic pathway genes and therefore enhanced Arabidopsis tolerance to heat stress. |
Application of sucrose modulates the expressions of genes involved in proline and polyamine metabolism in maize seedlings exposed to droughtC. Altuntaº, A. Sezgin, M. Demiralay, R. Terzi, A. Sağlam, A. KadioğluBiologia plantarum 63:247-252, 2019 | DOI: 10.32615/bp.2019.028 Sucrose, proline, and polyamines are compatible solutes accumulating in plant tissues and increasing cellular osmolarity under environmental stresses. These compatible solutes and hydrogen peroxide can function as signaling molecules in plants. There has been very little evidence how the supply of sucrose changes the biosynthesis of compatible solutes. This study aimed to assess the cross-talk among sucrose, H2O2, and compatible solutes on the expression of genes encoding key enzymes in the pathways of proline and polyamine metabolism in drought stressed maize seedlings. Drought stress (induced by polyethylene glycol solution) increased the expressions of genes encoding pyrroline-5-carboxylate synthetase (P5CS), arginine decarboxylase (ADC), and S-adenosylmethionine decarboxylase (SAMDC), while decreased proline dehydrogenase (ProDH), diamine oxidase (DAO), and polyamine oxidase (PAO) expressions. Addition of sucrose to the stressed seedlings increased the P5CS, ADC and SAMDC expressions more than drought stress alone and reduced more the ProDH, DAO, and PAO expressions. Moreover, exogenous sucrose increased leaf water potential and the content of proline, polyamines, and total soluble sugars, whereas decreased H2O2 content and membrane damages under the drought stress conditions. Consequently, exogenous sucrose contributed to the preservation of water status and the amelioration of damage in maize seedlings under the drought stress. |
Effects of drought on expression patterns of genes encoding the antioxidantenzymes associated with chloroplasts in wheatS.F. DANYALI, M. MOGHADDAM VAHED, S.S. ALAVIKIA, H. SAMIZADEH LAHIJI, M. NOROUZIBiologia plantarum 63:575-585, 2019 | DOI: 10.32615/bp.2019.055 Reactive oxygen species lead to cellular damage and in plants exposed to drought stress, an increasing expressions of genes encoding antioxidant enzymes play important protective roles. The aim of this study was to evaluate response of drought tolerant ('Arg' and 'Roshan') and drought sensitive ('Arta' and 'Navid') wheat cultivars to oxidative stress caused by drought. Relative water content (RWC), water loss rate (WLR), free proline content, malondialdehyde (MDA) accumulation, and peroxidase (POX) activity were measured after 2, 4, 6, and 8 h of dehydration. The tolerant cultivars had a higher RWC and lower MDA, proline content, POX activity and WLR as compared to the sensitive cultivars. Real-time quantitative PCR was used to measure the expressions of genes encoding antioxidant enzymes in chloroplastic thylakoids and stroma. The expressions of chloroplastic Cu/Zn superoxide dismutase, thylakoid-bound ascorbate peroxidase, mono-dehydroascorbate reductase, dehydroascorbate reductase, and chloroplastic glutathione reductase genes were up-regulated in the tolerant cultivars. A direct relationship between physiological traits and increased gene expressions was observed for both sensitive and tolerant cultivars. Overall, increasing gene expressions protect the plants from oxidative damage caused by dehydration stress and improves tolerance to this stress. |
Brassinosteroids and their role in response of plants to abiotic stressesQ. Fariduddin, M. Yusuf, I. Ahmad, A. AhmadBiologia plantarum 58:9-17, 2014 | DOI: 10.1007/s10535-013-0374-5 Brassinosteroids (BRs) are polyhydroxylated steroidal plant hormones that play pivotal role in the regulation of various plant growth and development processes. BR biosynthetic or signaling mutants clearly indicate that these plant steroids are essential for regulating a variety of physiological processes including cellular expansion and proliferation, vascular differentiation, male fertility, timing senescence, and leaf development. Moreover, BRs regulate the expression of hundreds of genes, affect the activity of numerous metabolic pathways, and help to control overall developmental programs leading to morphogenesis. On the other hand, the potential application of BRs in agriculture to improve growth and yield under various stress conditions including drought, salinity, extreme temperatures, and heavy metal (Cd, Cu, Al, and Ni) toxicity, is of immense significance as these stresses severely hamper the normal metabolism of plants. Keeping in mind the multifaceted role of BRs, an attempt has been made to cover the various aspects mediated by BRs particularly under stress conditions and a possible mechanism of action of BRs has also been suggested. |
Overexpression of the dominant negative nbexo70d1 mutantionconfers tolerance to salt stress in transgenic tobaccoN.N. TRINH, H.T. LE, T.P. NGUYENBiologia plantarum 63:484-495, 2019 | DOI: 10.32615/bp.2019.058 The vesicle trafficking process, which involves exocytotic and endocytotic pathways, has been reported to play a role in regulating plant responses to different environmental stresses. The Exo70 protein is important for the localization of the exocyst in the plasma membrane; however, its role in the physiology of stress tolerance is currently unclear. In this study, we characterized NbExo70D1, an Exo70 gene from tobacco (Nicotiana benthamiana). It was shown to have a role in the plant response to salt stress. More specifically, tolerance to salt stress is conferred by the overexpression of the dominant negative nbexo70d1 domain D mutation in transgenic tobacco. In addition, a reduced accumulation of reactive oxygen species (ROS) under salt treatment was observed in the transgenic lines compared to the wild type. Treatment with diphenylene iodonium, an NADPH oxidase inhibitor, resulted in a decrease in salt stress-triggered ROS production in the roots of both wild type tobacco and transgenic tobacco. Furthermore, there was a reduction in NADPH oxidase activity in the transgenic plants under salt treatment, which indicates NbExo70D1 is involved in NADPH oxidase-mediated ROS production. We also characterized the tissue-specific expression patterns of NbExo70D1 during salt stress response by expressing the ProNbExo70D1-β-glucuronidase reporter construct in plants. Importantly, the GFP-NbExo70D1 fusion protein was localized in both the plasma membrane and the cytoplasm; expressing the dominant negative mutation disrupted the interaction between NbExo70D1 protein and the plasma membrane. Overall, our study suggests that Exo70 plays an important role in regulating the production and transmission of ROS as part of a salt stress response in plants. |
Deficiency in phytochromobilin biosynthesis enhances heat-stress-induced impairments to the photosynthetic apparatus in tomatoA.J. Crispim Filho, A.C. Costa, F.R.R. Alves, P.F. Batista, A.A. Rodrigues, S.C. Vasconcelos Filho, K.J.T. NascimentoBiologia plantarum 63:134-144, 2019 | DOI: 10.32615/bp.2019.016 Plants are continuously exposed to unfavorable environmental conditions, such as heat stress, which negatively affect plant growth and productivity. There is evidence that phytochromes are involved in plant response to different abiotic stresses. We investigated the possible phytochrome-dependent responses to heat stress in photomorphogenic tomato mutants aurea (au, phytochromobilin-deficient, PΦB) and high-pigment 1 (hp1, hyperresponsive to phytochrome-mediated responses), as well as the wild-type Micro-Tom (MT). In comparison with MT, reductions in photosynthetic rate promoted by a high temperature were more pronounced in au, whereas less pronounced in hp1. All genotypes subjected to the heat stress exhibited adjustments in the capture and dissipation of energy, which were indicated by increases in the initial fluorescence and decreases in the maximum photochemical efficiency of photosystem II (PS II). The effective quantum yield of PS II and the apparent electron transport rate showed greatest alterations in the au mutant. In addition, heat-triggered anatomical changes occurred in all genotypes but were most conspicuous in the au mutant, followed by MT. Thus, phytochrome-dependent mechanisms played pivotal roles in the plant responses to the heat stress, and deficiency in phytochromobilin biosynthesis enhanced the heat-induced impairment of photosynthetic performance. |
Identification and characterization of catalase genes in Eleusine coracanaunder abiotic stressesS. SINGH, R. CHOPPERLA, S. KHAN, N. REDDY, J.C. PADARIA, A. MOLKUMAR, A.U. SOLANKEBiologia plantarum 63:440-447, 2019 | DOI: 10.32615/bp.2019.048 Reactive oxygen species (ROS) are byproducts of metabolic processes such as respiration and photosynthesis in plants. Production of ROS leads to rapid cell damage, and plants developed a complex system of enzymatic and non-enzymatic antioxidants to scavenge these ROS. Catalase is an important enzyme, which plays a key role in elimination of toxic effects of hydrogen peroxide and plays a major role as an antioxidant. When characterizing heat responsive genes in finger millet (Eleusine coracana L.) using a suppression subtractive hybridization (SSH) library, we isolated two catalase genes and named them as EcCATA1 and EcCATB1. The lengths of the EcCATA1 and EcCATB1 open reading frames were 1 482 and 1 426 bp, respectively. We characterized these genes under different abiotic stresses and in different tissues. The tissue wise expression revealed that EcCATA1 expression was higher in leaves whereas EcCATB1 expression was higher in roots than in other organs. Under stress conditions, the expression of EcCATA1 was highest under salt stress followed by mannitol treatment. In the case of EcCATB1, the highest expression was observed under mannitol treatment followed by cold and dehydration. We also studied expression of both the genes under heat stress in different finger millet genotypes and observed that expressions of these genes can be correlated with heat tolerance. For both the genes, a detailed computational investigation was also performed for understanding their structural properties and physicochemical characteristics. Overall, this is the first study to identify and characterize catalase genes from climate resilient finger millet crop. |


