Mitogen-activated protein kinases (MAPKs) are significant components of MAPK cascades, which play versatile roles in different transduction pathways to mediate stress adaptation. However, little information is known about post-transcriptional regulation of MAPK genes in plant under drought stress. MicroRNAs (miRNAs), a class of newly identified, short non-coding RNAs, regulate the expression of target genes in plant growth, development, and stress responses. In order to investigate the mechanism of miRNA regulating MAPK genes in potato, we identified a novel potato miRNA with the sequence CGGCCTTAATAAGATGGTGAAG and named it as stu-miR856 depending on miRNA deep sequencing and bioinformatic analysis. Target prediction indicates that it can bind to the coding sequence region of two potato MAPK-like genes, and cleavage positions of them were also effectively validated by RNA ligase-mediated 5' rapid amplification of cDNA ends assay. In addition, expressional analysis shows that stu-miR856 and its targets exhibited an opposite expression pattern: stu-miR856 expression significantly decreased while its target genes greatly increased in the different stages of drought treatment. The results indicate that a decreased expression of stu-miR856 might drive overexpression of two StMAPK genes family members, which may contribute to regulation of the drought adaptation of potato plants.

In the yeast Saccharomyces cerevisiae, the molecular chaperone HSP26 has the remarkable ability to sense increases in temperature directly and can switch from an inactive to a chaperone-active state. In this report, we analyzed the effect of expression of HSP26 in Arabidopsis thaliana plants and their response to high temperature stress. The hsp26 transgenic plants exhibited stronger growth than wild type plants at 45 °C for 16 h. The chlorophyll content and chlorophyll fluorescence decreased much more in wild type than in transgenic plants. Moreover, the transgenic plants had higher proline and soluble sugar contents, and lower relative electrical conductivity and malondialdehyde contents after high temperature stress. Furthermore, we found that over-expression of HSP26 in Arabidopsis increased the amount of free proline, elevated the expression of proline biosynthetic pathway genes and therefore enhanced Arabidopsis tolerance to heat stress.

Sucrose, proline, and polyamines are compatible solutes accumulating in plant tissues and increasing cellular osmolarity under environmental stresses. These compatible solutes and hydrogen peroxide can function as signaling molecules in plants. There has been very little evidence how the supply of sucrose changes the biosynthesis of compatible solutes. This study aimed to assess the cross-talk among sucrose, H₂O₂, and compatible solutes on the expression of genes encoding key enzymes in the pathways of proline and polyamine metabolism in drought stressed maize seedlings. Drought stress (induced by polyethylene glycol solution) increased the expressions of genes encoding pyrroline-5-carboxylate synthetase (P5CS), arginine decarboxylase (ADC), and S-adenosylmethionine decarboxylase (SAMDC), while decreased proline dehydrogenase (ProDH), diamine oxidase (DAO), and polyamine oxidase (PAO) expressions. Addition of sucrose to the stressed seedlings increased the P5CS, ADC and SAMDC expressions more than drought stress alone and reduced more the ProDH, DAO, and PAO expressions. Moreover, exogenous sucrose increased leaf water potential and the content of proline, polyamines, and total soluble sugars, whereas decreased H₂O₂ content and membrane damages under the drought stress conditions. Consequently, exogenous sucrose contributed to the preservation of water status and the amelioration of damage in maize seedlings under the drought stress.

Reactive oxygen species lead to cellular damage and in plants exposed to drought stress, an increasing expressions of genes encoding antioxidant enzymes play important protective roles. The aim of this study was to evaluate response of drought tolerant ('Arg' and 'Roshan') and drought sensitive ('Arta' and 'Navid') wheat cultivars to oxidative stress caused by drought. Relative water content (RWC), water loss rate (WLR), free proline content, malondialdehyde (MDA) accumulation, and peroxidase (POX) activity were measured after 2, 4, 6, and 8 h of dehydration. The tolerant cultivars had a higher RWC and lower MDA, proline content, POX activity and WLR as compared to the sensitive cultivars. Real-time quantitative PCR was used to measure the expressions of genes encoding antioxidant enzymes in chloroplastic thylakoids and stroma. The expressions of chloroplastic Cu/Zn superoxide dismutase, thylakoid-bound ascorbate peroxidase, mono-dehydroascorbate reductase, dehydroascorbate reductase, and chloroplastic glutathione reductase genes were up-regulated in the tolerant cultivars. A direct relationship between physiological traits and increased gene expressions was observed for both sensitive and tolerant cultivars. Overall, increasing gene expressions protect the plants from oxidative damage caused by dehydration stress and improves tolerance to this stress.

Brassinosteroids (BRs) are polyhydroxylated steroidal plant hormones that play pivotal role in the regulation of various plant growth and development processes. BR biosynthetic or signaling mutants clearly indicate that these plant steroids are essential for regulating a variety of physiological processes including cellular expansion and proliferation, vascular differentiation, male fertility, timing senescence, and leaf development. Moreover, BRs regulate the expression of hundreds of genes, affect the activity of numerous metabolic pathways, and help to control overall developmental programs leading to morphogenesis. On the other hand, the potential application of BRs in agriculture to improve growth and yield under various stress conditions including drought, salinity, extreme temperatures, and heavy metal (Cd, Cu, Al, and Ni) toxicity, is of immense significance as these stresses severely hamper the normal metabolism of plants. Keeping in mind the multifaceted role of BRs, an attempt has been made to cover the various aspects mediated by BRs particularly under stress conditions and a possible mechanism of action of BRs has also been suggested.

The vesicle trafficking process, which involves exocytotic and endocytotic pathways, has been reported to play a role in regulating plant responses to different environmental stresses. The Exo70 protein is important for the localization of the exocyst in the plasma membrane; however, its role in the physiology of stress tolerance is currently unclear. In this study, we characterized NbExo70D1, an Exo70 gene from tobacco (Nicotiana benthamiana). It was shown to have a role in the plant response to salt stress. More specifically, tolerance to salt stress is conferred by the overexpression of the dominant negative nbexo70d1 domain D mutation in transgenic tobacco. In addition, a reduced accumulation of reactive oxygen species (ROS) under salt treatment was observed in the transgenic lines compared to the wild type. Treatment with diphenylene iodonium, an NADPH oxidase inhibitor, resulted in a decrease in salt stress-triggered ROS production in the roots of both wild type tobacco and transgenic tobacco. Furthermore, there was a reduction in NADPH oxidase activity in the transgenic plants under salt treatment, which indicates NbExo70D1 is involved in NADPH oxidase-mediated ROS production. We also characterized the tissue-specific expression patterns of NbExo70D1 during salt stress response by expressing the ProNbExo70D1-β-glucuronidase reporter construct in plants. Importantly, the GFP-NbExo70D1 fusion protein was localized in both the plasma membrane and the cytoplasm; expressing the dominant negative mutation disrupted the interaction between NbExo70D1 protein and the plasma membrane. Overall, our study suggests that Exo70 plays an important role in regulating the production and transmission of ROS as part of a salt stress response in plants.

Plants are continuously exposed to unfavorable environmental conditions, such as heat stress, which negatively affect plant growth and productivity. There is evidence that phytochromes are involved in plant response to different abiotic stresses. We investigated the possible phytochrome-dependent responses to heat stress in photomorphogenic tomato mutants aurea (au, phytochromobilin-deficient, PΦB) and high-pigment 1 (hp1, hyperresponsive to phytochrome-mediated responses), as well as the wild-type Micro-Tom (MT). In comparison with MT, reductions in photosynthetic rate promoted by a high temperature were more pronounced in au, whereas less pronounced in hp1. All genotypes subjected to the heat stress exhibited adjustments in the capture and dissipation of energy, which were indicated by increases in the initial fluorescence and decreases in the maximum photochemical efficiency of photosystem II (PS II). The effective quantum yield of PS II and the apparent electron transport rate showed greatest alterations in the au mutant. In addition, heat-triggered anatomical changes occurred in all genotypes but were most conspicuous in the au mutant, followed by MT. Thus, phytochrome-dependent mechanisms played pivotal roles in the plant responses to the heat stress, and deficiency in phytochromobilin biosynthesis enhanced the heat-induced impairment of photosynthetic performance.

Reactive oxygen species (ROS) are byproducts of metabolic processes such as respiration and photosynthesis in plants. Production of ROS leads to rapid cell damage, and plants developed a complex system of enzymatic and non-enzymatic antioxidants to scavenge these ROS. Catalase is an important enzyme, which plays a key role in elimination of toxic effects of hydrogen peroxide and plays a major role as an antioxidant. When characterizing heat responsive genes in finger millet (Eleusine coracana L.) using a suppression subtractive hybridization (SSH) library, we isolated two catalase genes and named them as EcCATA1 and EcCATB1. The lengths of the EcCATA1 and EcCATB1 open reading frames were 1 482 and 1 426 bp, respectively. We characterized these genes under different abiotic stresses and in different tissues. The tissue wise expression revealed that EcCATA1 expression was higher in leaves whereas EcCATB1 expression was higher in roots than in other organs. Under stress conditions, the expression of EcCATA1 was highest under salt stress followed by mannitol treatment. In the case of EcCATB1, the highest expression was observed under mannitol treatment followed by cold and dehydration. We also studied expression of both the genes under heat stress in different finger millet genotypes and observed that expressions of these genes can be correlated with heat tolerance. For both the genes, a detailed computational investigation was also performed for understanding their structural properties and physicochemical characteristics. Overall, this is the first study to identify and characterize catalase genes from climate resilient finger millet crop.

The "Specific Tissue" (ST) are proteins of unknown function present only in some plant families, mainly Fabaceae and Asteraceae. They are included in the PF10950 protein family and characterized by the presence of at least one domain of unknown function (DUF)2775. In this work we studied the involvement of the six members of the Medicago truncatula ST family (ST1 to ST6) in the development of flowers, fruits, and seeds by analysing the activity of their promoters (pST) after the construction of M. truncatula transgenic plants expressing the b-glucuronidase (GUS) reporter gene under the control of the six pSTs. The GUS activity was analysed in whole flowers and fruits and also in histological sections of these organs. The pST expression in the reproductive organs was mainly associated with the vascular bundles, especially throughout fruit development. These results pointed to an important role of ST proteins during the reproductive development stage, related to nutrient mobilization during the fruit and seed formation, that could be facilitated by their presence in the pod vascular bundles, as well as in the connective tissue of the anthers (ST3, ST4, ST6), in the placenta, the funiculus, and the outer parts of the developing seed (ST2, ST3, ST6). The observations made in this study were in agreement with the functions previously established for the three groups of M. truncatula ST proteins, as in the proposed function for ST1 in the transport and assimilation of nutrients, or the involvement of ST4, ST5, and ST6 in floral defence.

Phalaenopsis species are among the most popular potted flowers for their fascinating flowers. When their whole-genome sequencing was completed, they have become useful for studying the molecular mechanism of anthocyanin biosynthesis. Here, we identified 49 candidate anthocyanin synthetic genes in the Phalaenopsis genome. Our results showed that duplication events might contribute to the expansion of some gene families, such as the genes encoding chalcone synthase (PeCHS), flavonoid 3'-hydroxylase (PeF3'H), and myeloblastosis (PeMYB). To elucidate their functions in anthocyanin biosynthesis, we conducted a global expression analysis. We found that anthocyanin synthesis occurred during the very early flower development stage and that the flavanone 3-hydroxylase (F3H), F3'H, and dihydroflavonol 4-reductase (DFR) genes played key roles in this process. Over-expression of Phalaenopsis flavonoid 3',5'-hydroxylase (F3'5'H) in petunia showed that it had no function in anthocyanin production. Furthermore, global analysis of sequences and expression patterns show that the regulatory genes are relatively conserved and might be important in regulating anthocyanin synthesis through different combined expression patterns. To determine the functions of MYB2, 11, and 12, we over-expressed them in petunia and performed yeast two-hybrid analysis with anthocyanin (AN)1 and AN11. The MYB2 protein had strong activity in regulating anthocyanin biosynthesis and induced significant pigment accumulation in transgenic plant petals, whereas MYB11 and MYB12 had lower activities. Our work provided important improvement in the understanding of anthocyanin biosynthesis and established a foundation for floral colour breeding in Phalaenopsis through genetic engineering.

Plants must precisely regulate their signalling pathways to respond to environmental changes promptly. Sucrose non fermenting1 (SNF1)-related protein kinases (SnRK) 2 are essential kinases in abiotic stress responses, including responses to abscisic acid. Although homologs of SnRKs in yeast require a γ-subunit for full activation, it has been unclear whether SnRK2s in higher plants are affected by γ-subunits. In this report, we aimed to show the effect of Arabidopsis KIN γ-subunit 1 (KING1), which is a potential γ-subunit, on the activity of SnRK2. A recombinant KING1 bound to SnRK2.6 and functionally inhibited its activity in vitro. On the other hand, KING1 facilitated the activity of SnRK2.2. Structural models suggest that significant structural changes occurred as a result of KING1 binding to the C-terminal tail of SnRK2s. Since KING1 inhibited the kinase activity of a chimeric protein consisting of the N-terminal domain of SnRK2.6 and the C-terminal domain of SnRK2.2, regulation by KING1 was determined by the N-terminal domain of SnRK2s. Together, these results show that KING1 can mediate activity of SnRK2s in vitro.

Drought is a major factor decreasing the growth, development, and productivity of rice in about one-third of the world area. The characterization of genes imparting tolerance to drought in rice, is an attractive strategy for genetic engineering to improve drought tolerance. It is demonstrated that ectopic overexpression of Brachypodium distachyon RING-H₂ finger gene (designated as BdRHP1) enhances drought tolerance in rice at both the vegetative and reproductive stages. When subjected to drought, positive transgenic lines showed delayed wilting, and improved recovery after rewatering. However, the transgenic plants exhibited more significant germination delay and shoot and root growth arrest than WT under 5 μM abscisic acid (ABA) treatment. When they were subjected to drought at the reproductive stage, the transgenic plants lost water more slowly compared to WT and they had higher leaf relative water content. After 28 d of slow progressive soil drying, transgenic plants recovered better after rewatering and flowered earlier than WT plants. The yield of water-stressed transgenic plants was higher than that of WT plants. Together, the data suggest that BdRHP1 has a specific function in positive modulation of improving drought tolerance in rice.

Potato (Solanum tuberosum L.), a plant of great economic importance worldwide, is known to be highly sensitive to salinity. Improving the tolerance of this crop was envisaged using interspecific somatic hybridization. In this report, the impact of salinity on three hybrid lines (STBa, STBc, and STBd) produced by protoplast fusion between the cv. BF15 and the wild species Solanum berthaultii was investigated in vitro. An analysis of plant response to oxidative stress was considered when plantlets were submitted to 100 mM NaCl for 5 d. The peroxidation of membrane lipids was screened by measuring malondialdehyde accumulation in these lines. Moreover, gene expressions and activities of antioxidant enzymes, such as catalase (CAT), peroxidase (POX), and superoxide dismutase (SOD), were assessed. The results show a lower degree of lipid peroxidation in the hybrid lines in comparison to the BF15 parent. These hybrids also showed higher activities of CAT, POX, and SOD than the BF15, especially in roots. The significant inductions of FeSOD, (Cu-Zn)SOD, MnSOD, and CAT genes in hybrid plants suggest their participation in salt tolerance. The differential expressions of the SOD and CAT genes between leaves and roots also indicate their tissue specificity.

The effect of NaCl on the photosynthetic pathways of the only halophytic subtropical species Sedum uniflorum was examined in the field in northern Taiwan and in the laboratory. Plants growing in the field exhibited CAM-cycling regardless of salt content in their tissues. In contrast, NaCl treatment in the laboratory induced CAM photosynthesis, while control plants exhibited a C₃-CAM intermediacy. This high level of photosynthetic pathway variablility matches that of other Sedum species.

Oxidative stress plays an important role in plant ageing and in response to different stresses. Oxidative DNA damage, unless repaired, may have detrimental consequences and increase genetic instability. Therefore, we determined the role of heat-shock induced oxidative stress on induction and repair of DNA damage in relation to oxidative stress tolerance in senescent tobacco plants. One-month-old (young) and three-month-old (senescent) plants were exposed to 42 °C for 2 and 4 h and left to recover at 26 °C for 24 and 72 h. The progression of senescence was characterized by the lower soluble protein and malondialdehyde content compared to young plants. Immediately after the heat shock, an increase in lipid peroxidation and guaiacol peroxidase activity, as well as DNA damage measured by the Comet assay were induced to higher extent in the young plants than in the senescent ones compared to their respective controls. Moreover, after 24-h recovery, the DNA damage further increased in the young plants whereas tendency of DNA repair was observed in the senescent plants. Upon 72-h recovery, no significant differences were noticed in all parameters studied (regardless of plant age) compared to the controls. The random amplified polymorphic DNA (RAPD) analysis confirmed genetic stability of the tobacco plants during the heat-shock exposures as well as the subsequent recovery periods.

To understand the protective roles of salicylic acid (SA) under high light, we investigated oxidative damage of Arabidopsis thaliana under high light in the presence or absence of SA. The results indicate that the high light led to an increase in the levels of proline, soluble sugars, reactive oxygen species, malondialdehyde, and electrolyte leakage, and a decrease in stomatal conductance (gs). Activities of six antioxidant enzymes increased significantly under the high light for 1 h. However, the high light for 3 h decreased the activities of peroxidase, superoxide dismutase, and catalase. In addition, we found that exogenous SA effectively improved antioxidant enzyme activities and significantly alleviated ROS accumulation and cell death in A. thaliana under the high light. Therefore, our results show that the high light caused a severe oxidative damage, and SA effectively alleviated the adverse effects of the high light on the plants by regulating the antioxidative defense system.

In non-heading Chinese cabbage, the yield relies mostly on the health of leaves, which can be heavily impacted by turnip mosaic virus (TuMV). The virions or viral ribonucleoprotein complexes are transported through the phloem and xylem. Plasmodesmata are indispensable because they traverse cell walls and connect companion cells, allowing virus particles long distance movement. However, which complexes and genes participate in this process is still unknown. Plants can activate defense mechanisms and apply disease resistance genes to respond to pathogen attacks. In this study, we collected the stems and petioles infected by TuMV for 7 d (TuMV-7), 14 d (TuMV-14), and 21 d (TuMV-21). Using isobaric tags for relative and absolute quantification-based proteomic technology, 6 043 distinct proteins were identified and 323, 240, 285, 203, 253, and 363 differentially expressed proteins were found in the comparable pairs of TuMV-7/control, TuMV-14/TuMV-7, TuMV-14/control, TuMV-21/TuMV-7, TuMV-21/TuMV-14, and TuMV-21/control, respectively. We performed a functional annotation analysis of all identified proteins and a functional enrichment analysis of all differentially expressed proteins. The results indicated that the long distance movement of TuMV involved many complex regulatory pathways. The respective proteins were related to those occurring in plasmodesmata and to Ca²⁺ transporters. Further, we also found proteins related to heat shock proteins, pathogenesis-related proteins, and proteins scavenging reactive oxygen species.

Salinity adversely affects plants resulting in disruption to plant growth and physiology. Previously, it has been shown that these negative effects can be alleviated by various exogenous polyamines. However, the role of spermidine (Spd) in conferring salinity tolerance in sorghum is not well documented. The effect of exogenous Spd on the responses of sweet sorghum (Sorghum bicolor L.) seedlings to salt stress (150 mM NaCl) was investigated by measuring photosynthetic carbon assimilation, Calvin cycle enzyme activities, and the the expression of respective genes. Application of 0.25 mM Spd alleviated the negative effects of salt stress on efficiency of photosystem II and CO₂ assimilation and increased the activities of ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco) and aldolase. Salt stress significantly lowered the transcriptions of genes encoding Rubisco large subunit, Rubisco small subunit, 3-phosphoglyceric acid kinase, glyceraldehyde-3-phosphate dehydrogenase, triose-3-phosphate isomerase, fructose-1,6-bisphosphate aldolase, fructose-1,6-bisphosphate phosphatase, and sedoheptulose-1,7-bisphosphatase. However, transcriptions of genes encoding phosphoribokinase and Rubisco were up-regulated. The Spd application enhanced expressions of most of these genes. It appears Spd conferred salinity tolerance to sweet sorghum seedlings by enhancing photosynthetic efficiency through regulation of gene expressions and activities of key CO₂ assimilation enzymes.

Cannabis sativa, an annual herbaceous plant, produce wide variety of secondary metabolites among which delta-9-tetrahydrocannabinol (THC) is the most important one. The dissection of biosynthetic pathway(s) of this compound and its regulation by transcription factors (TFs) is an important prerequisite for efficient biotechnological manipulation of its secondary metabolome. A polyketide synthase (PKS) of C. sativa catalyzes the first step of cannabinoid biosynthesis, leading to the biosynthesis of olivetolic acid. Cloning and analysis of PKS promoter based on online PLACE, PlantCARE, and Genomatix Matinspector professional databases, indicated that PKS promoter consisted of cis-elements such as TATA-box, CAAT-box, W-box, Myb-box, E-box, and P-box. Plant expression vector PKS::GUS was constructed in such a way that the ATG of the PKS gene was in the frame with the β-glucuronidase (GUS) coding region. Using a combinatorial transient GUS expression system in Nicotiana benthamania leaves, it was shown that heterologous TFs such as HlWRKY1, HlMYB3, HlWDR1 and HlbZIP1 from Humulus lupulus significantly activated PKS promoter. Moreover, Tombusvirus p19 core protein, which is known for silencing suppressor functions, acted in our combinatorial transient expression system as an enhancer of PKS promoter activity along with hop TFs. Our analyses suggested the involvement of the hop derived TFs (HlWRKY1, HlMYB3, HlWDR1 and HlbZIP1A) and p19 in the activation of PKS gene promoter, which could be used for the genetic manipulation of C. sativa to enhance the cannabinoid production.

Circular RNAs (circRNAs), an emerging class of non-coding RNAs, are abundant in eukaryotic transcriptomes. Seed germination is one of the most important stages in the entire life cycle of plants that can be slowed down or totally restrained by high temperature. Our aim is to identify heat-responsive circRNAs and explore the potential function of circRNAs in tomato seeds at high temperature. Following high-throughput sequencing, 4 164 circRNAs were identified, and 980 circRNAs were shared in the control and high-temperature libraries. Among the 748 circRNAs with high expressions, 73 circRNAs were significantly up-/down- regulated in tomato seeds germinated at high temperature compared to the control. The parental genes of circRNAs existing in seeds only at high temperature were mainly involved in metabolic processes, cellular processes, catalytic activities, and binding based on Gene Ontology analysis. The results suggested that circRNAs were widespread in tomato and were generated from different chromosomes and diverse genomic regions. Some circRNAs in tomato seeds responded to high temperature during germination. This study provides the first genome-wide profile of circRNAs in response to high temperature during tomato seed germination and lays a foundation for studying the potential biological functions of circRNAs responding to heat stress.

A transcription factor gene Arachis hypogaea abscisic acid (ABA) responsive element binding protein 1 (AhAREB1) has been isolated from peanut previously. Here, the function of different domains from AhAREB1 was investigated using construct series containing AhAREB1 full-length and truncated fragments to transform peanut hairy roots and pAhNCED1 (promoter of Arachis hypogaea 9-cis-epoxycarotenoid dioxygenase 1) GUS/Col Arabidopsis thaliana, respectively. The results of real-time quantitative PCR, transient expression, and chromosome immunoprecipitation (ChIP) assay all showed that AhAREB1 negatively regulated the expression of the AhNCED1 gene. β-Glucuronidase (GUS) staining shows that AhAREB1 and the AhAREB1 gene truncated fragment A1 may be bound to ABA responsive element  motifs in the promoter region of AhNCED1 and involved in the negative regulation of the upstream AhNCED1 gene promoter, reflected by the inhibited expression of the AhNCED1 promoter reporter gene and significantly reduced GUS activity in transgenic A. thaliana plants. Furthermore, only the full variant of AhAREB1 and a fragment without a C1 domain had repression activity on the AhNCED1 promoter. On the contrary, the AhAREB1 gene truncated fragments A2 and A3 variant without a C2 domain had no such repression activity. Moreover, the negative regulation of AhNCED1 was detected only when the C2 domain was present suggesting that the C2 domain was required for AhAREB1 activity. Subcellular localization analysis shows that the deletion of conserved domains C1, C2, C3 had no effects on the nuclear localization of AhAREB1. In addition, ChIP analysis indicates that the deletion of domains C1 and C3 significantly affected the binding of the AhAREB1 transcription factor to the AhNCED1 promoter. Taken together, the results indicate that the different N-terminal domains of the AhAREB1 protein, which played different roles in the negative regulations of AhNCED1, were necessary for AhNCED1 transcription.

In order to understand mechanisms of ontogenic resistance to apple scab, we analyzed various aspects of young and old leaves. We have introduced an apple plants cultivation system where in vitro propagated and rooting explants produce a genetically uniform population of apple (Malus domestica cv. Idared) plants. In this work, we demonstrate that apple plants produced in our cultivation system showed susceptibility to Venturia inaequalis, the cause of apple scab disease in young leaves and resistance in old leaves, which is similar to orchard situation. Our analysis shows that the cessation of epidermal cell expansion and shape formation coincided with the onset of ontogenic resistance in older leaves. Formation of specific cuticular lamellar structures did not coincide with ontogenic resistance onset. Further, chemical composition analysis of wax from young susceptible and old resistant leaves did not reveal specific compounds involved in ontogenic resistance. Differences in homogalacturonan content in cell walls in susceptible and resistant cells as well as decreased methylesterification of pectin in resistant leaves suggest that polysaccharide composition of the cell wall may play a role in mycelium growth and nutrition.

Apyrases belong to the ATPase family of enzymes that hydrolyze phosphoanhydride bonds of nucleoside tri- and di-phosphates. These enzymes differ markedly from other phosphohydrolases due to their high specific activity, broad divalent cation requirement, broad nucleotide substrate specificity, and insensitivity to various inhibitors. In the past 30 years, apyrases have been frequently studied in mammals. In comparison, research of apyrases in plants has received little attention, despite the growth of plants being closely related to the apyrases. In this review, we summarize the research of the apyrases in Arabidopsis thaliana and point to the possible future directions of research. Apyrases have seven members found in Arabidopsis thaliana, each with different properties and functions. Currently, the characterization and functions of AtAPY1 and AtAPY2 have been reported, though, to the best of our knowledge, the other apyrase members (AtAPY3 to 7) have not yet been sufficiently described. In this review, we also summarize the progress being made and the difficulties encountered in apyrase research in Arabidopsis thaliana.

Strawberry tree (Arbutus unedo) is a small perennial tree that grows spontaneously in the Mediterranean basin, Ireland, and Portugal. In this work, strawberry tree clones were established in vitro from epicormic shoots obtained from a young tree, an adult tree, and from a seedling. They were propagated by axillary shoot buds proliferation on solid and in liquid media, and also in a modified De Fossard medium with 9 µM benzylaminopurine. The organogenesis from calli obtained from apical leaves of the in vitro grown shoots from the three genotypes was carried out in the same basal liquid medium supplemented with 9 µM thidiazuron. Micropropagation through organogenesis in liquid medium proved to be more efficient than the other tested methods (considering the number of shoots produced), but the shoots were showing hyperhydricity. Shoots were sucessufully rooted on medium with indole-3-butyric acid and acclimatized ex vitro with rates higher than 90 %. Six month-old plants from the most proliferative genotype (AU1) and propagated in vitro by different methods were submitted to drought stress (no watering for 10 d) and several morphological and physiological parameters were evaluated and compared to a control group (watered to 70 % field capacity). No significant differences were found in plant biomass, root length, and plant height, however, slight differences were observed in water potential, net photosynthetic rate, intercellular CO₂ concentration, and stomatal conductance between the plantlets propagated on solid or liquid medium. In general, the responses to drought stress imposed were was similar in plants micropropagated by different propagation methods.

The increasing world population and limited amount of land area appropriate for intensive agriculture necessitate high-yield cultivars. The focus is on the enrichment of existing crops deficient in nutrients, which is also called biofortification. Microelements, vitamins, and fatty acids belong to most important traits being subjected to biofortification. Biofortification strategies can be divided on fertilization-based strategy, which is characterized by direct application of nutrients or plant growth promoting substances on plants, and biotechnological strategy, which involves molecular biology techniques in order to enhance transport, production, and accumulation of nutrients. Recent advances in plant biotechnology, such as genome-editing, clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9, and transcription activator-like effector nuclease, as well as an extensive study of genetic diversity, are acceptable approaches to the development of biofortified crops.

In plants, calcineurin B-like proteins (CBLs) and CBL-interacting protein kinases (CIPKs) regulate Ca2+ signalling and so responses to biotic and abiotic stresses. However, the details of specific CIPKs functions in various stress responses are poorly understood. Here, we report roles of dicot and monocot CIPK2 genes in response to salinity and heavy metals. Arabidopsis thaliana AtCIPK2 was found to be universally expressed in different tissues and organs and furthermore induced by salinity. Overexpression of AtCIPK2 or Tibetan Plateau wild barley (Hordeum spontaneum) HsCIPK2 in Arabidopsis alleviated toxic effects of NaCl and mercury on seed germination and root growth. Similarly, reduced toxic effects of copper and cadmium on seed germination, but not on root growth, were observed in these transgenic lines. Live-cell fluorescence imaging analysis revealed that HsCIPK2 was predominantly distributed in the cytoplasm and nucleus and weakly localized at the plasma membrane (PM), but its PM association was rapidly enhanced upon exposure to high salinity and mercury. These results suggest an involvement of CIPK2 in plant tolerance to salinity and mercury and provide a new insight into physiological functions of CIPKs in plant response to heavy metals.

Our research intended to appraise the performance of two different Pseudomonas strains on Zea mays L. (cv. B73) under drought stress and non-stress conditions. Plants were inoculated with P. putida KT2440 (Pp) and P. fluorescens (Pf1) followed by sampling at 0, 3^rd, and 6^th day after imposition of drought stress (DAS). Both strains demonstrated significant improvement in root length, protein content, chlorophyll content, and root and shoot fresh masses as compared to un-inoculated drought stressed plants. Real-time quantitative PCR analysis revealed that drought stress responsive genes, i.e., the cold-related dehydrin 410 gene, WRKY18, and major facilitator superfamily were significantly down-regulated by Pf1 and Pp inoculation under drought stress condition on 6 DAS. Similarly, the down-regulated transcript abundance of lipoxygenase genes in inoculated plants on 6 DAS showed the role of Pf1 and Pp in scavenging reactive oxygen species under drought stress conditions. Among the selected jasmonic acid pathway responsive genes, maize protease inhibitor and 12-oxo-phytodienoatereductase 7 (OPR7) also revealed a potential role of these rhizobacteria under drought stress conditions. Seed inoculation of both strains significantly down-regulated the expression of OPR7 gene under stress conditions. Our results advocate the complex growth promotion effects of both selected rhizobacterial strains and amelioration of the drought by modulating the expression of drought stress responsive genes.

Ethylene response factor (ERF) is a key transcription factor of plant ethylene signaling pathway, which plays an important role in plant response to abiotic and biotic stresses by regulating the expression of downstream genes. However, little is known about the mechanisms of the regulation of gene expression by ERF proteins. Chloroplast is an essential organelle that is important for photosynthesis and biosynthesis of many essential metabolites. There exists an interaction between chloroplasts and the nucleus. Chloroplasts can send multiple kinds of signals to regulate the nuclear gene expression known as retrograde signaling. In our study, we have analyzed the expression of the components related to plastid retrograde signaling pathway to elucidate the mechanism of tomato ethylene responsive factor 1 (TERF1) in response to drought stress. Our results showed that TERF1 can regulate different biogenic and operational retrograde signals to regulate nuclear genes expression, which can improve plant tolerance to drought stress. We also propose a new potential of TERF1 in regulating nuclear gene expression, including regulation of different phytohormone signaling pathways and gene posttranscriptional modification triggered by different retrograde signals. Our results have enriched our knowledge about the function of ERF proteins and ethylene signaling pathway.

An inhibitor of DNA methylation 5-azacytidine (5A) is a chemical analog of the nucleoside cytidine. This study investigated the influence of 5A-induced DNA hypomethylation on the accumulation of somatic DNA mutations (nucleotide substitutions, indels) in the Actin2 3′ untranslated region, nuclear internal transcribed spacer ITS1-5.8rRNA-ITS2, and the ribulose-1,5-bisphosphate carboxylase/oxygenase gene of Arabidopsis thaliana and analyzed concurrent changes in the expression of DNA methyltransferase and DNA repair genes. The 5A treatment (20 mg per 100 g of soil) decreased DNA methylation, and the detected 5A-induced demethylation was associated with the up-regulation of the DNA methyltransferase genes: chromomethylase AtCMT3, methyltransferase AtMETI, and domains rearranged methyltransferases AtDRM1 and AtDRM2. Cultivation of plants in the presence of 5A led to a considerable increase in the number of single nucleotide substitutions in the analyzed DNA regions of 5A-treated A. thaliana. The 5A treatment significantly increased the transcriptions of 7 DNA repair genes (endonuclease AtARP, DNA demethylases AtDME and AtDML2, DNA glycosylase AtMBD4, DNA damage-binding protein AtDDB1, and photolyases AtUVR2 and AtUVR3) out of the 17 analyzed genes from the base excision repair, nucleotide excision repair, and photoreactivation pathways. However, 5A decreased the transcription of DNA 3′-phosphatase AtZDP, DNA repair protein AtRad23a, mismatch repair proteins AtMsh2 and AtMsh3. It is possible that the changes in the transcription of the DNA repair genes contributed to the detected increase in the number of single nucleotide substitutions that accumulated in the 5A-treated A. thaliana. Taken together, the data indicate that there is an interaction between the processes of DNA methylation and mutation accumulation.

Several studies revealed the important contribution of calcineurin B-like (CBLs) and CBL-interacting kinase (CIPKs) genes in transmitting stress signals in plants. Taking advantage from the genome sequences of the cultivated potato Solanum tuberosum and its wild relatives S. commersonii and S. chacoense, we identified for the first time 10 CBLs and 26 CIPKs genes in each species. The CBLs and CIPKs derived from tandem duplications indicate that these gene families in potato mainly arise through amplification mechanisms. Once annotated, we compared the par excellence model of Arabidopsis thaliana with S. commersonii, the potato model species for studying cold tolerance. We found that four ScCBL proteins (ScCBL1, ScCBL4a, ScCBL4b, and ScCBL9) started with a conserved N-myristoylation motif (MGXXXS/T), which might function in membrane targeting of the CBLs-CIPKs complex. Additionally, expression analyses of S. commersonii CBL and CIPK genes based on RNAseq revealed diverse expression patterns following various abiotic and biotic stresses and in the four tissues analyzed (flowers, leaf, roots, and tubers). Data also suggest that the ScCBLs-ScCIPKs complex may be more responsive to abiotic rather than biotic stimuli. Overall, the results described in the present work will be useful for future investigations and for functional characterization of individual CBLs and CIPKs in Solanum.